Incidental Mutation 'R4796:Smarcal1'
ID369004
Institutional Source Beutler Lab
Gene Symbol Smarcal1
Ensembl Gene ENSMUSG00000039354
Gene NameSWI/SNF related matrix associated, actin dependent regulator of chromatin, subfamily a-like 1
Synonyms6030401P21Rik, Mharp
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4796 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location72583251-72633134 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 72597440 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 425 (V425I)
Ref Sequence ENSEMBL: ENSMUSP00000137833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047615] [ENSMUST00000133123] [ENSMUST00000152225]
Predicted Effect probably benign
Transcript: ENSMUST00000047615
AA Change: V425I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000047589
Gene: ENSMUSG00000039354
AA Change: V425I

DomainStartEndE-ValueType
low complexity region 31 51 N/A INTRINSIC
Pfam:HARP 214 268 3.6e-26 PFAM
Pfam:HARP 302 356 1.2e-26 PFAM
DEXDc 391 564 7.01e-17 SMART
low complexity region 632 641 N/A INTRINSIC
HELICc 697 780 8.17e-18 SMART
low complexity region 879 889 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133123
SMART Domains Protein: ENSMUSP00000114848
Gene: ENSMUSG00000039354

DomainStartEndE-ValueType
low complexity region 31 51 N/A INTRINSIC
Pfam:HARP 66 106 1.7e-14 PFAM
Pfam:HARP 140 194 2.2e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136498
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150725
Predicted Effect probably benign
Transcript: ENSMUST00000152225
AA Change: V425I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000137833
Gene: ENSMUSG00000039354
AA Change: V425I

DomainStartEndE-ValueType
low complexity region 31 51 N/A INTRINSIC
Pfam:HARP 214 268 8e-29 PFAM
Pfam:HARP 302 356 3e-26 PFAM
DEXDc 391 564 7.01e-17 SMART
low complexity region 632 641 N/A INTRINSIC
HELICc 697 780 8.17e-18 SMART
low complexity region 879 889 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152814
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156797
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein shows sequence similarity to the E. coli RNA polymerase-binding protein HepA. Mutations in this gene are a cause of Schimke immunoosseous dysplasia (SIOD), an autosomal recessive disorder with the diagnostic features of spondyloepiphyseal dysplasia, renal dysfunction, and T-cell immunodeficiency. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display reduced B cell counts and increased susceptibility to heat induced mortality. Treatment of homozygous null mice with alpha-amanitin results in phenotypes similar to Schimke Type Immunoosseous Dysplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230104L09Rik A G 2: 148,850,738 F48S probably damaging Het
9930021J03Rik G A 19: 29,753,618 H665Y probably benign Het
Adgrv1 C T 13: 81,155,231 W132* probably null Het
Atp8b3 A G 10: 80,524,354 V961A probably damaging Het
Bglap A C 3: 88,384,405 I4S unknown Het
Bmp1 T C 14: 70,492,073 probably null Het
Btaf1 T C 19: 36,956,428 L152P possibly damaging Het
Cacna1b T A 2: 24,637,487 T1621S possibly damaging Het
Capn3 A T 2: 120,502,998 N621I probably damaging Het
Ccdc59 T C 10: 105,841,568 S23P probably benign Het
Cd22 A T 7: 30,872,956 probably null Het
Cdh20 A G 1: 104,941,264 D160G probably damaging Het
Cep112 T C 11: 108,486,992 probably null Het
Clock T C 5: 76,265,916 K44R probably damaging Het
Coq10b A G 1: 55,071,798 T242A probably damaging Het
Ctnnd1 G T 2: 84,619,926 R317S probably damaging Het
Dlg5 G A 14: 24,144,383 H1674Y probably damaging Het
Drc3 C A 11: 60,363,528 N75K probably damaging Het
Efna4 T C 3: 89,335,248 E113G probably damaging Het
Egr3 C A 14: 70,077,575 A44D probably benign Het
Ercc3 T C 18: 32,248,310 F393S probably damaging Het
Evi2 T A 11: 79,515,447 probably benign Het
Fam78b T C 1: 167,078,647 V125A probably benign Het
Fars2 A T 13: 36,537,426 E448V probably damaging Het
Farsb A T 1: 78,425,196 *590R probably null Het
Fat3 A G 9: 15,999,732 M1658T probably benign Het
Fhod3 G T 18: 24,985,301 V232F probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Fzd3 A G 14: 65,235,158 V387A possibly damaging Het
Gm14085 T A 2: 122,514,459 I182N probably damaging Het
Gm1527 A G 3: 28,920,663 I542V possibly damaging Het
Gm6583 A G 5: 112,355,299 S180P possibly damaging Het
Gm7964 A G 7: 83,755,901 probably null Het
Hbs1l G T 10: 21,342,506 G301C probably damaging Het
Hipk4 A G 7: 27,528,570 H247R probably benign Het
Hmcn1 A G 1: 150,753,611 V965A probably benign Het
Hoxa5 C T 6: 52,203,963 A130T probably benign Het
Igf2r C T 17: 12,684,126 V2346I possibly damaging Het
Igsf8 T C 1: 172,316,322 V14A probably benign Het
Impg1 G A 9: 80,394,095 P183L probably damaging Het
Isl1 T C 13: 116,305,430 N89S probably benign Het
Itga1 C A 13: 115,035,385 W61C probably damaging Het
Itga5 T C 15: 103,347,760 R922G probably benign Het
Itgb5 T C 16: 33,885,021 V227A possibly damaging Het
Jph4 G T 14: 55,109,708 P461T probably damaging Het
Kcnab1 T A 3: 65,304,165 probably null Het
Klrc1 T A 6: 129,677,762 probably null Het
Lonrf2 A T 1: 38,816,038 L92Q probably benign Het
Ly75 T C 2: 60,349,940 E631G probably benign Het
Mapk13 T C 17: 28,775,554 Y140H probably damaging Het
Mgat4d A G 8: 83,358,120 E164G probably damaging Het
Mkl1 C T 15: 81,017,033 S419N probably damaging Het
Mthfs A T 9: 89,240,025 H188L probably benign Het
Muc5b T A 7: 141,864,246 M3643K possibly damaging Het
Mylk3 T C 8: 85,350,385 Y474C probably damaging Het
Myo5b A G 18: 74,744,630 T1567A possibly damaging Het
Ncaph2 T G 15: 89,370,807 V478G probably damaging Het
Ncbp1 A G 4: 46,152,967 R247G possibly damaging Het
Nedd9 T C 13: 41,317,900 K208E probably benign Het
Nxph2 C T 2: 23,399,858 T74M probably benign Het
Ogdh T A 11: 6,340,570 M385K probably benign Het
Olfr1239 T C 2: 89,417,891 H174R probably damaging Het
Olfr2 C T 7: 107,001,335 G175D probably damaging Het
Olfr402 A T 11: 74,155,591 I146F probably benign Het
Olfr713 A T 7: 107,036,914 Y253F probably benign Het
Olfr830 T C 9: 18,876,179 V284A probably damaging Het
Olfr921 T A 9: 38,775,374 F40I probably benign Het
Pcsk2 A C 2: 143,813,425 I510L probably benign Het
Pdgfra A G 5: 75,189,311 N952S probably benign Het
Pex26 T C 6: 121,193,557 F287S probably damaging Het
Pick1 G C 15: 79,255,610 probably benign Het
Plxnb1 G T 9: 109,114,595 V1917L probably damaging Het
Polk T C 13: 96,489,256 T347A probably benign Het
Ppp1r10 T G 17: 35,924,087 I61R probably damaging Het
Prex1 A T 2: 166,592,291 L503Q probably damaging Het
Ptp4a1 A C 1: 30,943,938 I133R probably damaging Het
Rassf10 G T 7: 112,954,528 R112L probably damaging Het
Ripor3 T A 2: 167,981,340 I884F probably damaging Het
Rnft2 A G 5: 118,201,246 Y369H probably damaging Het
Rtp3 A T 9: 110,986,454 V281E probably benign Het
Runx1t1 T A 4: 13,837,767 N51K probably damaging Het
Selp A G 1: 164,144,906 T705A probably benign Het
Sgca A T 11: 94,970,727 probably null Het
Slc22a3 T C 17: 12,423,788 E514G probably damaging Het
Slc2a1 G A 4: 119,132,445 R61Q probably damaging Het
Soga1 A G 2: 157,020,252 S1586P probably benign Het
Ssx2ip T C 3: 146,418,359 V43A probably benign Het
Synpo A G 18: 60,604,314 S187P probably damaging Het
Thnsl1 T A 2: 21,212,045 C203* probably null Het
Tldc1 A T 8: 119,768,354 S222T probably benign Het
Ttyh3 A T 5: 140,634,786 I232N probably damaging Het
Upk1b T C 16: 38,787,242 H41R probably benign Het
Vmn2r76 T C 7: 86,230,444 D216G possibly damaging Het
Zan A T 5: 137,380,850 C5329* probably null Het
Zbtb40 C T 4: 136,998,642 M535I probably benign Het
Zfp383 A C 7: 29,914,838 T173P possibly damaging Het
Zfp7 T A 15: 76,891,346 C529* probably null Het
Other mutations in Smarcal1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Smarcal1 APN 1 72616565 missense possibly damaging 0.80
IGL01658:Smarcal1 APN 1 72586131 missense probably benign 0.00
IGL01980:Smarcal1 APN 1 72616520 nonsense probably null
IGL02007:Smarcal1 APN 1 72595940 missense probably damaging 0.98
IGL02153:Smarcal1 APN 1 72633055 utr 3 prime probably benign
IGL02496:Smarcal1 APN 1 72620088 missense probably damaging 1.00
IGL03084:Smarcal1 APN 1 72598935 splice site probably null
IGL03135:Smarcal1 APN 1 72616501 splice site probably null
IGL03306:Smarcal1 APN 1 72626466 missense probably benign 0.12
R0133:Smarcal1 UTSW 1 72632851 missense probably benign 0.05
R0315:Smarcal1 UTSW 1 72595811 nonsense probably null
R0396:Smarcal1 UTSW 1 72626473 missense probably benign 0.03
R0891:Smarcal1 UTSW 1 72598856 missense probably damaging 0.99
R1799:Smarcal1 UTSW 1 72585961 missense probably damaging 0.97
R1854:Smarcal1 UTSW 1 72586099 missense possibly damaging 0.77
R3725:Smarcal1 UTSW 1 72626596 missense possibly damaging 0.88
R3726:Smarcal1 UTSW 1 72626596 missense possibly damaging 0.88
R4164:Smarcal1 UTSW 1 72626689 intron probably benign
R4438:Smarcal1 UTSW 1 72611478 intron probably benign
R4722:Smarcal1 UTSW 1 72611337 missense probably damaging 1.00
R4989:Smarcal1 UTSW 1 72632860 missense possibly damaging 0.84
R5242:Smarcal1 UTSW 1 72591083 missense probably benign 0.00
R5367:Smarcal1 UTSW 1 72595976 critical splice donor site probably null
R5418:Smarcal1 UTSW 1 72598909 missense probably benign 0.01
R5430:Smarcal1 UTSW 1 72626617 missense probably damaging 1.00
R5591:Smarcal1 UTSW 1 72591253 missense probably damaging 1.00
R5607:Smarcal1 UTSW 1 72586213 missense probably benign 0.00
R5809:Smarcal1 UTSW 1 72591137 missense probably benign 0.09
R6395:Smarcal1 UTSW 1 72616557 missense possibly damaging 0.82
R6447:Smarcal1 UTSW 1 72585874 missense probably damaging 0.96
R6852:Smarcal1 UTSW 1 72591173 missense possibly damaging 0.75
R7060:Smarcal1 UTSW 1 72612942 missense probably damaging 1.00
R7692:Smarcal1 UTSW 1 72586020 missense probably benign 0.08
R8232:Smarcal1 UTSW 1 72626563 missense probably damaging 1.00
Z1177:Smarcal1 UTSW 1 72591267 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTAGGAAACGTCTTGCTGTG -3'
(R):5'- CCTTAAAAGACCCCAGGGCTTG -3'

Sequencing Primer
(F):5'- AGAACCCATTCTGGTCAGTG -3'
(R):5'- GCCCCGGCACTGTTATTTTGATG -3'
Posted On2016-02-04