Incidental Mutation 'R4796:Selp'
ID369008
Institutional Source Beutler Lab
Gene Symbol Selp
Ensembl Gene ENSMUSG00000026580
Gene Nameselectin, platelet
SynonymsGrmp, CD62P, P-selectin
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R4796 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location164115264-164150026 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 164144906 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 705 (T705A)
Ref Sequence ENSEMBL: ENSMUSP00000123924 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000162746]
PDB Structure
Structure of the SNX17 atypical FERM domain bound to the NPxY motif of P-selectin [X-RAY DIFFRACTION]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133341
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160000
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161020
Predicted Effect probably benign
Transcript: ENSMUST00000161152
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161943
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162102
Predicted Effect probably benign
Transcript: ENSMUST00000162746
AA Change: T705A

PolyPhen 2 Score 0.147 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000123924
Gene: ENSMUSG00000026580
AA Change: T705A

DomainStartEndE-ValueType
CLECT 30 159 2.89e-16 SMART
EGF 162 195 1.97e-4 SMART
CCP 200 257 1.31e-14 SMART
CCP 262 319 4.02e-15 SMART
CCP 324 381 5.91e-13 SMART
CCP 386 443 1.46e-12 SMART
CCP 448 505 3.9e-13 SMART
CCP 510 567 1.95e-13 SMART
CCP 580 637 1.97e-9 SMART
CCP 642 699 3.9e-13 SMART
transmembrane domain 711 733 N/A INTRINSIC
PDB:4GXB|B 741 768 2e-12 PDB
Meta Mutation Damage Score 0.0674 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 140 kDa protein that is stored in the alpha-granules of platelets and Weibel-Palade bodies of endothelial cells. This protein redistributes to the plasma membrane during platelet activation and degranulation and mediates the interaction of activated endothelial cells or platelets with leukocytes. The membrane protein is a calcium-dependent receptor that binds to sialylated forms of Lewis blood group carbohydrate antigens on neutrophils and monocytes. Alternative splice variants may occur but are not well documented. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit mildly attenuated inflammatory responses, increased numbers of circulating neutrophils, lack of leukocyte rolling in mesenteric venules, and increased survival after Plasmodium berghei infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230104L09Rik A G 2: 148,850,738 F48S probably damaging Het
9930021J03Rik G A 19: 29,753,618 H665Y probably benign Het
Adgrv1 C T 13: 81,155,231 W132* probably null Het
Atp8b3 A G 10: 80,524,354 V961A probably damaging Het
Bglap A C 3: 88,384,405 I4S unknown Het
Bmp1 T C 14: 70,492,073 probably null Het
Btaf1 T C 19: 36,956,428 L152P possibly damaging Het
Cacna1b T A 2: 24,637,487 T1621S possibly damaging Het
Capn3 A T 2: 120,502,998 N621I probably damaging Het
Ccdc59 T C 10: 105,841,568 S23P probably benign Het
Cd22 A T 7: 30,872,956 probably null Het
Cdh20 A G 1: 104,941,264 D160G probably damaging Het
Cep112 T C 11: 108,486,992 probably null Het
Clock T C 5: 76,265,916 K44R probably damaging Het
Coq10b A G 1: 55,071,798 T242A probably damaging Het
Ctnnd1 G T 2: 84,619,926 R317S probably damaging Het
Dlg5 G A 14: 24,144,383 H1674Y probably damaging Het
Drc3 C A 11: 60,363,528 N75K probably damaging Het
Efna4 T C 3: 89,335,248 E113G probably damaging Het
Egr3 C A 14: 70,077,575 A44D probably benign Het
Ercc3 T C 18: 32,248,310 F393S probably damaging Het
Evi2 T A 11: 79,515,447 probably benign Het
Fam78b T C 1: 167,078,647 V125A probably benign Het
Fars2 A T 13: 36,537,426 E448V probably damaging Het
Farsb A T 1: 78,425,196 *590R probably null Het
Fat3 A G 9: 15,999,732 M1658T probably benign Het
Fhod3 G T 18: 24,985,301 V232F probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Fzd3 A G 14: 65,235,158 V387A possibly damaging Het
Gm14085 T A 2: 122,514,459 I182N probably damaging Het
Gm1527 A G 3: 28,920,663 I542V possibly damaging Het
Gm6583 A G 5: 112,355,299 S180P possibly damaging Het
Gm7964 A G 7: 83,755,901 probably null Het
Hbs1l G T 10: 21,342,506 G301C probably damaging Het
Hipk4 A G 7: 27,528,570 H247R probably benign Het
Hmcn1 A G 1: 150,753,611 V965A probably benign Het
Hoxa5 C T 6: 52,203,963 A130T probably benign Het
Igf2r C T 17: 12,684,126 V2346I possibly damaging Het
Igsf8 T C 1: 172,316,322 V14A probably benign Het
Impg1 G A 9: 80,394,095 P183L probably damaging Het
Isl1 T C 13: 116,305,430 N89S probably benign Het
Itga1 C A 13: 115,035,385 W61C probably damaging Het
Itga5 T C 15: 103,347,760 R922G probably benign Het
Itgb5 T C 16: 33,885,021 V227A possibly damaging Het
Jph4 G T 14: 55,109,708 P461T probably damaging Het
Kcnab1 T A 3: 65,304,165 probably null Het
Klrc1 T A 6: 129,677,762 probably null Het
Lonrf2 A T 1: 38,816,038 L92Q probably benign Het
Ly75 T C 2: 60,349,940 E631G probably benign Het
Mapk13 T C 17: 28,775,554 Y140H probably damaging Het
Mgat4d A G 8: 83,358,120 E164G probably damaging Het
Mkl1 C T 15: 81,017,033 S419N probably damaging Het
Mthfs A T 9: 89,240,025 H188L probably benign Het
Muc5b T A 7: 141,864,246 M3643K possibly damaging Het
Mylk3 T C 8: 85,350,385 Y474C probably damaging Het
Myo5b A G 18: 74,744,630 T1567A possibly damaging Het
Ncaph2 T G 15: 89,370,807 V478G probably damaging Het
Ncbp1 A G 4: 46,152,967 R247G possibly damaging Het
Nedd9 T C 13: 41,317,900 K208E probably benign Het
Nxph2 C T 2: 23,399,858 T74M probably benign Het
Ogdh T A 11: 6,340,570 M385K probably benign Het
Olfr1239 T C 2: 89,417,891 H174R probably damaging Het
Olfr2 C T 7: 107,001,335 G175D probably damaging Het
Olfr402 A T 11: 74,155,591 I146F probably benign Het
Olfr713 A T 7: 107,036,914 Y253F probably benign Het
Olfr830 T C 9: 18,876,179 V284A probably damaging Het
Olfr921 T A 9: 38,775,374 F40I probably benign Het
Pcsk2 A C 2: 143,813,425 I510L probably benign Het
Pdgfra A G 5: 75,189,311 N952S probably benign Het
Pex26 T C 6: 121,193,557 F287S probably damaging Het
Pick1 G C 15: 79,255,610 probably benign Het
Plxnb1 G T 9: 109,114,595 V1917L probably damaging Het
Polk T C 13: 96,489,256 T347A probably benign Het
Ppp1r10 T G 17: 35,924,087 I61R probably damaging Het
Prex1 A T 2: 166,592,291 L503Q probably damaging Het
Ptp4a1 A C 1: 30,943,938 I133R probably damaging Het
Rassf10 G T 7: 112,954,528 R112L probably damaging Het
Ripor3 T A 2: 167,981,340 I884F probably damaging Het
Rnft2 A G 5: 118,201,246 Y369H probably damaging Het
Rtp3 A T 9: 110,986,454 V281E probably benign Het
Runx1t1 T A 4: 13,837,767 N51K probably damaging Het
Sgca A T 11: 94,970,727 probably null Het
Slc22a3 T C 17: 12,423,788 E514G probably damaging Het
Slc2a1 G A 4: 119,132,445 R61Q probably damaging Het
Smarcal1 G A 1: 72,597,440 V425I probably benign Het
Soga1 A G 2: 157,020,252 S1586P probably benign Het
Ssx2ip T C 3: 146,418,359 V43A probably benign Het
Synpo A G 18: 60,604,314 S187P probably damaging Het
Thnsl1 T A 2: 21,212,045 C203* probably null Het
Tldc1 A T 8: 119,768,354 S222T probably benign Het
Ttyh3 A T 5: 140,634,786 I232N probably damaging Het
Upk1b T C 16: 38,787,242 H41R probably benign Het
Vmn2r76 T C 7: 86,230,444 D216G possibly damaging Het
Zan A T 5: 137,380,850 C5329* probably null Het
Zbtb40 C T 4: 136,998,642 M535I probably benign Het
Zfp383 A C 7: 29,914,838 T173P possibly damaging Het
Zfp7 T A 15: 76,891,346 C529* probably null Het
Other mutations in Selp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01627:Selp APN 1 164143892 critical splice acceptor site probably null
IGL02430:Selp APN 1 164126383 missense probably damaging 1.00
IGL02591:Selp APN 1 164130133 missense probably damaging 1.00
IGL02883:Selp APN 1 164130102 missense probably benign 0.00
IGL02945:Selp APN 1 164133929 missense probably damaging 1.00
PIT4812001:Selp UTSW 1 164132263 missense probably benign 0.29
R1571:Selp UTSW 1 164126607 missense probably damaging 1.00
R1731:Selp UTSW 1 164141440 nonsense probably null
R1758:Selp UTSW 1 164132285 missense possibly damaging 0.64
R1834:Selp UTSW 1 164128160 splice site probably null
R1951:Selp UTSW 1 164126512 missense probably benign 0.36
R1953:Selp UTSW 1 164126512 missense probably benign 0.36
R1987:Selp UTSW 1 164142758 missense probably damaging 0.98
R2244:Selp UTSW 1 164137286 nonsense probably null
R2484:Selp UTSW 1 164143954 missense probably benign 0.43
R2484:Selp UTSW 1 164143955 missense probably damaging 1.00
R3440:Selp UTSW 1 164123775 missense probably benign 0.17
R3831:Selp UTSW 1 164132280 nonsense probably null
R3958:Selp UTSW 1 164126286 missense probably benign 0.03
R4795:Selp UTSW 1 164144906 missense probably benign 0.15
R4807:Selp UTSW 1 164143936 missense probably damaging 1.00
R4832:Selp UTSW 1 164126340 missense probably damaging 1.00
R4917:Selp UTSW 1 164144906 missense probably damaging 0.99
R4921:Selp UTSW 1 164141397 missense possibly damaging 0.93
R5399:Selp UTSW 1 164126586 missense possibly damaging 0.93
R5734:Selp UTSW 1 164143891 splice site probably benign
R5752:Selp UTSW 1 164137242 missense probably damaging 1.00
R6035:Selp UTSW 1 164141510 missense probably benign 0.44
R6035:Selp UTSW 1 164141510 missense probably benign 0.44
R6185:Selp UTSW 1 164126346 missense probably damaging 1.00
R6555:Selp UTSW 1 164141602 intron probably null
R6955:Selp UTSW 1 164144909 missense possibly damaging 0.94
R7106:Selp UTSW 1 164126422 missense probably benign 0.12
R7677:Selp UTSW 1 164133956 missense probably damaging 1.00
R7831:Selp UTSW 1 164145015 critical splice donor site probably null
R7914:Selp UTSW 1 164145015 critical splice donor site probably null
Z1176:Selp UTSW 1 164126432 missense probably benign 0.00
Z1177:Selp UTSW 1 164144898 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TTAGGATGCAGACAGTCCCTG -3'
(R):5'- TGTTTCCAAACAGCAACTACTG -3'

Sequencing Primer
(F):5'- TCTGCTACAGTGGATTTCTGAC -3'
(R):5'- TCCAAACAGCAACTACTGACTTTATC -3'
Posted On2016-02-04