Incidental Mutation 'R4796:Igsf8'
ID369010
Institutional Source Beutler Lab
Gene Symbol Igsf8
Ensembl Gene ENSMUSG00000038034
Gene Nameimmunoglobulin superfamily, member 8
SynonymsPGRL, KCT-4, ESTM34, EWI-2, PG regulatory-like protein
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4796 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location172261641-172319841 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 172316322 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 14 (V14A)
Ref Sequence ENSEMBL: ENSMUSP00000134280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039506] [ENSMUST00000062387] [ENSMUST00000085912] [ENSMUST00000128508] [ENSMUST00000139528] [ENSMUST00000195659]
Predicted Effect probably benign
Transcript: ENSMUST00000039506
AA Change: V77A

PolyPhen 2 Score 0.067 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000041232
Gene: ENSMUSG00000038034
AA Change: V77A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG 32 147 1.38e-6 SMART
low complexity region 155 166 N/A INTRINSIC
IG 169 285 2.3e-3 SMART
IG 309 433 9.49e-5 SMART
IG 445 571 3.59e-5 SMART
transmembrane domain 578 600 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000062387
SMART Domains Protein: ENSMUSP00000060110
Gene: ENSMUSG00000038026

DomainStartEndE-ValueType
low complexity region 9 21 N/A INTRINSIC
Pfam:IRK 25 350 3.1e-142 PFAM
low complexity region 362 377 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085912
AA Change: V77A

PolyPhen 2 Score 0.067 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000083076
Gene: ENSMUSG00000038034
AA Change: V77A

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
IG 32 147 1.38e-6 SMART
low complexity region 155 166 N/A INTRINSIC
IG 169 285 2.3e-3 SMART
IG 309 433 9.49e-5 SMART
IG 445 571 3.59e-5 SMART
transmembrane domain 578 600 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128508
AA Change: V77A

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000122611
Gene: ENSMUSG00000038034
AA Change: V77A

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
IG 32 147 1.38e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139528
AA Change: V14A

PolyPhen 2 Score 0.067 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000134280
Gene: ENSMUSG00000038034
AA Change: V14A

DomainStartEndE-ValueType
IG_like 19 84 3.66e1 SMART
low complexity region 92 103 N/A INTRINSIC
IG 106 222 2.3e-3 SMART
IG 246 370 9.49e-5 SMART
IG 382 508 3.59e-5 SMART
transmembrane domain 515 537 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150598
Predicted Effect probably benign
Transcript: ENSMUST00000194505
Predicted Effect probably benign
Transcript: ENSMUST00000195659
SMART Domains Protein: ENSMUSP00000141313
Gene: ENSMUSG00000038034

DomainStartEndE-ValueType
Blast:IG 1 67 2e-42 BLAST
SCOP:d1nkr_1 6 64 1e-3 SMART
transmembrane domain 74 96 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member the EWI subfamily of the immunoglobulin protein superfamily. Members of this family contain a single transmembrane domain, an EWI (Glu-Trp-Ile)-motif and a variable number of immunoglobulin domains. This protein interacts with the tetraspanins CD81 and CD9 and may regulate their role in certain cellular functions including cell migration and viral infection. The encoded protein may also function as a tumor suppressor by inhibiting the proliferation of certain cancers. Alternate splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230104L09Rik A G 2: 148,850,738 F48S probably damaging Het
9930021J03Rik G A 19: 29,753,618 H665Y probably benign Het
Adgrv1 C T 13: 81,155,231 W132* probably null Het
Atp8b3 A G 10: 80,524,354 V961A probably damaging Het
Bglap A C 3: 88,384,405 I4S unknown Het
Bmp1 T C 14: 70,492,073 probably null Het
Btaf1 T C 19: 36,956,428 L152P possibly damaging Het
Cacna1b T A 2: 24,637,487 T1621S possibly damaging Het
Capn3 A T 2: 120,502,998 N621I probably damaging Het
Ccdc59 T C 10: 105,841,568 S23P probably benign Het
Cd22 A T 7: 30,872,956 probably null Het
Cdh20 A G 1: 104,941,264 D160G probably damaging Het
Cep112 T C 11: 108,486,992 probably null Het
Clock T C 5: 76,265,916 K44R probably damaging Het
Coq10b A G 1: 55,071,798 T242A probably damaging Het
Ctnnd1 G T 2: 84,619,926 R317S probably damaging Het
Dlg5 G A 14: 24,144,383 H1674Y probably damaging Het
Drc3 C A 11: 60,363,528 N75K probably damaging Het
Efna4 T C 3: 89,335,248 E113G probably damaging Het
Egr3 C A 14: 70,077,575 A44D probably benign Het
Ercc3 T C 18: 32,248,310 F393S probably damaging Het
Evi2 T A 11: 79,515,447 probably benign Het
Fam78b T C 1: 167,078,647 V125A probably benign Het
Fars2 A T 13: 36,537,426 E448V probably damaging Het
Farsb A T 1: 78,425,196 *590R probably null Het
Fat3 A G 9: 15,999,732 M1658T probably benign Het
Fhod3 G T 18: 24,985,301 V232F probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Fzd3 A G 14: 65,235,158 V387A possibly damaging Het
Gm14085 T A 2: 122,514,459 I182N probably damaging Het
Gm1527 A G 3: 28,920,663 I542V possibly damaging Het
Gm6583 A G 5: 112,355,299 S180P possibly damaging Het
Gm7964 A G 7: 83,755,901 probably null Het
Hbs1l G T 10: 21,342,506 G301C probably damaging Het
Hipk4 A G 7: 27,528,570 H247R probably benign Het
Hmcn1 A G 1: 150,753,611 V965A probably benign Het
Hoxa5 C T 6: 52,203,963 A130T probably benign Het
Igf2r C T 17: 12,684,126 V2346I possibly damaging Het
Impg1 G A 9: 80,394,095 P183L probably damaging Het
Isl1 T C 13: 116,305,430 N89S probably benign Het
Itga1 C A 13: 115,035,385 W61C probably damaging Het
Itga5 T C 15: 103,347,760 R922G probably benign Het
Itgb5 T C 16: 33,885,021 V227A possibly damaging Het
Jph4 G T 14: 55,109,708 P461T probably damaging Het
Kcnab1 T A 3: 65,304,165 probably null Het
Klrc1 T A 6: 129,677,762 probably null Het
Lonrf2 A T 1: 38,816,038 L92Q probably benign Het
Ly75 T C 2: 60,349,940 E631G probably benign Het
Mapk13 T C 17: 28,775,554 Y140H probably damaging Het
Mgat4d A G 8: 83,358,120 E164G probably damaging Het
Mkl1 C T 15: 81,017,033 S419N probably damaging Het
Mthfs A T 9: 89,240,025 H188L probably benign Het
Muc5b T A 7: 141,864,246 M3643K possibly damaging Het
Mylk3 T C 8: 85,350,385 Y474C probably damaging Het
Myo5b A G 18: 74,744,630 T1567A possibly damaging Het
Ncaph2 T G 15: 89,370,807 V478G probably damaging Het
Ncbp1 A G 4: 46,152,967 R247G possibly damaging Het
Nedd9 T C 13: 41,317,900 K208E probably benign Het
Nxph2 C T 2: 23,399,858 T74M probably benign Het
Ogdh T A 11: 6,340,570 M385K probably benign Het
Olfr1239 T C 2: 89,417,891 H174R probably damaging Het
Olfr2 C T 7: 107,001,335 G175D probably damaging Het
Olfr402 A T 11: 74,155,591 I146F probably benign Het
Olfr713 A T 7: 107,036,914 Y253F probably benign Het
Olfr830 T C 9: 18,876,179 V284A probably damaging Het
Olfr921 T A 9: 38,775,374 F40I probably benign Het
Pcsk2 A C 2: 143,813,425 I510L probably benign Het
Pdgfra A G 5: 75,189,311 N952S probably benign Het
Pex26 T C 6: 121,193,557 F287S probably damaging Het
Pick1 G C 15: 79,255,610 probably benign Het
Plxnb1 G T 9: 109,114,595 V1917L probably damaging Het
Polk T C 13: 96,489,256 T347A probably benign Het
Ppp1r10 T G 17: 35,924,087 I61R probably damaging Het
Prex1 A T 2: 166,592,291 L503Q probably damaging Het
Ptp4a1 A C 1: 30,943,938 I133R probably damaging Het
Rassf10 G T 7: 112,954,528 R112L probably damaging Het
Ripor3 T A 2: 167,981,340 I884F probably damaging Het
Rnft2 A G 5: 118,201,246 Y369H probably damaging Het
Rtp3 A T 9: 110,986,454 V281E probably benign Het
Runx1t1 T A 4: 13,837,767 N51K probably damaging Het
Selp A G 1: 164,144,906 T705A probably benign Het
Sgca A T 11: 94,970,727 probably null Het
Slc22a3 T C 17: 12,423,788 E514G probably damaging Het
Slc2a1 G A 4: 119,132,445 R61Q probably damaging Het
Smarcal1 G A 1: 72,597,440 V425I probably benign Het
Soga1 A G 2: 157,020,252 S1586P probably benign Het
Ssx2ip T C 3: 146,418,359 V43A probably benign Het
Synpo A G 18: 60,604,314 S187P probably damaging Het
Thnsl1 T A 2: 21,212,045 C203* probably null Het
Tldc1 A T 8: 119,768,354 S222T probably benign Het
Ttyh3 A T 5: 140,634,786 I232N probably damaging Het
Upk1b T C 16: 38,787,242 H41R probably benign Het
Vmn2r76 T C 7: 86,230,444 D216G possibly damaging Het
Zan A T 5: 137,380,850 C5329* probably null Het
Zbtb40 C T 4: 136,998,642 M535I probably benign Het
Zfp383 A C 7: 29,914,838 T173P possibly damaging Het
Zfp7 T A 15: 76,891,346 C529* probably null Het
Other mutations in Igsf8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Igsf8 APN 1 172317544 missense possibly damaging 0.48
IGL02090:Igsf8 APN 1 172312589 intron probably benign
IGL02523:Igsf8 APN 1 172319413 utr 3 prime probably benign
IGL03092:Igsf8 APN 1 172312529 intron probably benign
IGL03184:Igsf8 APN 1 172318632 missense probably damaging 0.96
R0398:Igsf8 UTSW 1 172317499 missense probably damaging 1.00
R0468:Igsf8 UTSW 1 172318796 missense probably damaging 1.00
R0494:Igsf8 UTSW 1 172318698 missense probably benign 0.06
R0612:Igsf8 UTSW 1 172319407 makesense probably null
R0613:Igsf8 UTSW 1 172317589 missense probably benign 0.00
R0883:Igsf8 UTSW 1 172316259 missense possibly damaging 0.67
R0941:Igsf8 UTSW 1 172316396 missense probably damaging 1.00
R1689:Igsf8 UTSW 1 172318937 missense probably damaging 0.99
R1706:Igsf8 UTSW 1 172317405 missense probably damaging 1.00
R2050:Igsf8 UTSW 1 172318865 missense probably damaging 1.00
R2182:Igsf8 UTSW 1 172290728 critical splice donor site probably null
R3625:Igsf8 UTSW 1 172317769 missense probably benign 0.18
R3833:Igsf8 UTSW 1 172318270 missense probably benign 0.00
R4674:Igsf8 UTSW 1 172318912 nonsense probably null
R6768:Igsf8 UTSW 1 172317532 missense probably damaging 1.00
R7519:Igsf8 UTSW 1 172316307 missense probably benign 0.38
Z1176:Igsf8 UTSW 1 172318354 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTTTACCCCACAGGAACCAGG -3'
(R):5'- AGAGCTCAGTACCTCTCAGC -3'

Sequencing Primer
(F):5'- CACAGGAACCAGGTGCTACG -3'
(R):5'- CACTGTAGTTGCCCAGGTAC -3'
Posted On2016-02-04