Incidental Mutation 'R4796:Igsf8'
ID 369010
Institutional Source Beutler Lab
Gene Symbol Igsf8
Ensembl Gene ENSMUSG00000038034
Gene Name immunoglobulin superfamily, member 8
Synonyms KCT-4, PGRL, PG regulatory-like protein, EWI-2, ESTM34
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4796 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 172139934-172147410 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 172143889 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 14 (V14A)
Ref Sequence ENSEMBL: ENSMUSP00000134280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039506] [ENSMUST00000062387] [ENSMUST00000085912] [ENSMUST00000128508] [ENSMUST00000139528] [ENSMUST00000195659]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000039506
AA Change: V77A

PolyPhen 2 Score 0.067 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000041232
Gene: ENSMUSG00000038034
AA Change: V77A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG 32 147 1.38e-6 SMART
low complexity region 155 166 N/A INTRINSIC
IG 169 285 2.3e-3 SMART
IG 309 433 9.49e-5 SMART
IG 445 571 3.59e-5 SMART
transmembrane domain 578 600 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000062387
SMART Domains Protein: ENSMUSP00000060110
Gene: ENSMUSG00000038026

DomainStartEndE-ValueType
low complexity region 9 21 N/A INTRINSIC
Pfam:IRK 25 350 3.1e-142 PFAM
low complexity region 362 377 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085912
AA Change: V77A

PolyPhen 2 Score 0.067 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000083076
Gene: ENSMUSG00000038034
AA Change: V77A

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
IG 32 147 1.38e-6 SMART
low complexity region 155 166 N/A INTRINSIC
IG 169 285 2.3e-3 SMART
IG 309 433 9.49e-5 SMART
IG 445 571 3.59e-5 SMART
transmembrane domain 578 600 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128508
AA Change: V77A

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000122611
Gene: ENSMUSG00000038034
AA Change: V77A

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
IG 32 147 1.38e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139528
AA Change: V14A

PolyPhen 2 Score 0.067 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000134280
Gene: ENSMUSG00000038034
AA Change: V14A

DomainStartEndE-ValueType
IG_like 19 84 3.66e1 SMART
low complexity region 92 103 N/A INTRINSIC
IG 106 222 2.3e-3 SMART
IG 246 370 9.49e-5 SMART
IG 382 508 3.59e-5 SMART
transmembrane domain 515 537 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150598
Predicted Effect probably benign
Transcript: ENSMUST00000195659
SMART Domains Protein: ENSMUSP00000141313
Gene: ENSMUSG00000038034

DomainStartEndE-ValueType
Blast:IG 1 67 2e-42 BLAST
SCOP:d1nkr_1 6 64 1e-3 SMART
transmembrane domain 74 96 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194505
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member the EWI subfamily of the immunoglobulin protein superfamily. Members of this family contain a single transmembrane domain, an EWI (Glu-Trp-Ile)-motif and a variable number of immunoglobulin domains. This protein interacts with the tetraspanins CD81 and CD9 and may regulate their role in certain cellular functions including cell migration and viral infection. The encoded protein may also function as a tumor suppressor by inhibiting the proliferation of certain cancers. Alternate splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 C T 13: 81,303,350 (GRCm39) W132* probably null Het
Atp8b3 A G 10: 80,360,188 (GRCm39) V961A probably damaging Het
Bglap A C 3: 88,291,712 (GRCm39) I4S unknown Het
Bmp1 T C 14: 70,729,513 (GRCm39) probably null Het
Brd10 G A 19: 29,731,018 (GRCm39) H665Y probably benign Het
Btaf1 T C 19: 36,933,828 (GRCm39) L152P possibly damaging Het
Cacna1b T A 2: 24,527,499 (GRCm39) T1621S possibly damaging Het
Capn3 A T 2: 120,333,479 (GRCm39) N621I probably damaging Het
Ccdc121rt3 A G 5: 112,503,165 (GRCm39) S180P possibly damaging Het
Ccdc59 T C 10: 105,677,429 (GRCm39) S23P probably benign Het
Cd22 A T 7: 30,572,381 (GRCm39) probably null Het
Cdh20 A G 1: 104,868,989 (GRCm39) D160G probably damaging Het
Cep112 T C 11: 108,377,818 (GRCm39) probably null Het
Clock T C 5: 76,413,763 (GRCm39) K44R probably damaging Het
Coq10b A G 1: 55,110,957 (GRCm39) T242A probably damaging Het
Cstdc2 A G 2: 148,692,658 (GRCm39) F48S probably damaging Het
Ctnnd1 G T 2: 84,450,270 (GRCm39) R317S probably damaging Het
Dlg5 G A 14: 24,194,451 (GRCm39) H1674Y probably damaging Het
Drc3 C A 11: 60,254,354 (GRCm39) N75K probably damaging Het
Efna4 T C 3: 89,242,555 (GRCm39) E113G probably damaging Het
Egr3 C A 14: 70,315,024 (GRCm39) A44D probably benign Het
Ercc3 T C 18: 32,381,363 (GRCm39) F393S probably damaging Het
Evi2 T A 11: 79,406,273 (GRCm39) probably benign Het
Fam78b T C 1: 166,906,216 (GRCm39) V125A probably benign Het
Fars2 A T 13: 36,721,400 (GRCm39) E448V probably damaging Het
Farsb A T 1: 78,401,833 (GRCm39) *590R probably null Het
Fat3 A G 9: 15,911,028 (GRCm39) M1658T probably benign Het
Fhod3 G T 18: 25,118,358 (GRCm39) V232F probably damaging Het
Fkbpl G A 17: 34,864,303 (GRCm39) A24T probably benign Het
Fzd3 A G 14: 65,472,607 (GRCm39) V387A possibly damaging Het
Gm1527 A G 3: 28,974,812 (GRCm39) I542V possibly damaging Het
Gm7964 A G 7: 83,405,109 (GRCm39) probably null Het
Hbs1l G T 10: 21,218,405 (GRCm39) G301C probably damaging Het
Hipk4 A G 7: 27,227,995 (GRCm39) H247R probably benign Het
Hmcn1 A G 1: 150,629,362 (GRCm39) V965A probably benign Het
Hoxa5 C T 6: 52,180,943 (GRCm39) A130T probably benign Het
Igf2r C T 17: 12,903,013 (GRCm39) V2346I possibly damaging Het
Impg1 G A 9: 80,301,377 (GRCm39) P183L probably damaging Het
Isl1 T C 13: 116,441,966 (GRCm39) N89S probably benign Het
Itga1 C A 13: 115,171,921 (GRCm39) W61C probably damaging Het
Itga5 T C 15: 103,256,187 (GRCm39) R922G probably benign Het
Itgb5 T C 16: 33,705,391 (GRCm39) V227A possibly damaging Het
Jph4 G T 14: 55,347,165 (GRCm39) P461T probably damaging Het
Kcnab1 T A 3: 65,211,586 (GRCm39) probably null Het
Klrc1 T A 6: 129,654,725 (GRCm39) probably null Het
Lonrf2 A T 1: 38,855,119 (GRCm39) L92Q probably benign Het
Ly75 T C 2: 60,180,284 (GRCm39) E631G probably benign Het
Mapk13 T C 17: 28,994,528 (GRCm39) Y140H probably damaging Het
Meak7 A T 8: 120,495,093 (GRCm39) S222T probably benign Het
Mgat4d A G 8: 84,084,749 (GRCm39) E164G probably damaging Het
Mrtfa C T 15: 80,901,234 (GRCm39) S419N probably damaging Het
Mtcl2 A G 2: 156,862,172 (GRCm39) S1586P probably benign Het
Mthfs A T 9: 89,122,078 (GRCm39) H188L probably benign Het
Muc5b T A 7: 141,417,983 (GRCm39) M3643K possibly damaging Het
Mylk3 T C 8: 86,077,014 (GRCm39) Y474C probably damaging Het
Myo5b A G 18: 74,877,701 (GRCm39) T1567A possibly damaging Het
Ncaph2 T G 15: 89,255,010 (GRCm39) V478G probably damaging Het
Ncbp1 A G 4: 46,152,967 (GRCm39) R247G possibly damaging Het
Nedd9 T C 13: 41,471,376 (GRCm39) K208E probably benign Het
Nxph2 C T 2: 23,289,870 (GRCm39) T74M probably benign Het
Ogdh T A 11: 6,290,570 (GRCm39) M385K probably benign Het
Or10a5 A T 7: 106,636,121 (GRCm39) Y253F probably benign Het
Or3a1c A T 11: 74,046,417 (GRCm39) I146F probably benign Het
Or4a2 T C 2: 89,248,235 (GRCm39) H174R probably damaging Het
Or6a2 C T 7: 106,600,542 (GRCm39) G175D probably damaging Het
Or7g18 T C 9: 18,787,475 (GRCm39) V284A probably damaging Het
Or8b54 T A 9: 38,686,670 (GRCm39) F40I probably benign Het
Pcsk2 A C 2: 143,655,345 (GRCm39) I510L probably benign Het
Pdgfra A G 5: 75,349,972 (GRCm39) N952S probably benign Het
Pex26 T C 6: 121,170,516 (GRCm39) F287S probably damaging Het
Pick1 G C 15: 79,139,810 (GRCm39) probably benign Het
Plxnb1 G T 9: 108,943,663 (GRCm39) V1917L probably damaging Het
Polk T C 13: 96,625,764 (GRCm39) T347A probably benign Het
Ppp1r10 T G 17: 36,234,979 (GRCm39) I61R probably damaging Het
Prex1 A T 2: 166,434,211 (GRCm39) L503Q probably damaging Het
Ptp4a1 A C 1: 30,983,019 (GRCm39) I133R probably damaging Het
Rassf10 G T 7: 112,553,735 (GRCm39) R112L probably damaging Het
Ripor3 T A 2: 167,823,260 (GRCm39) I884F probably damaging Het
Rnft2 A G 5: 118,339,311 (GRCm39) Y369H probably damaging Het
Rtp3 A T 9: 110,815,522 (GRCm39) V281E probably benign Het
Runx1t1 T A 4: 13,837,767 (GRCm39) N51K probably damaging Het
Selp A G 1: 163,972,475 (GRCm39) T705A probably benign Het
Sgca A T 11: 94,861,553 (GRCm39) probably null Het
Slc22a3 T C 17: 12,642,675 (GRCm39) E514G probably damaging Het
Slc28a2b T A 2: 122,344,940 (GRCm39) I182N probably damaging Het
Slc2a1 G A 4: 118,989,642 (GRCm39) R61Q probably damaging Het
Smarcal1 G A 1: 72,636,599 (GRCm39) V425I probably benign Het
Ssx2ip T C 3: 146,124,114 (GRCm39) V43A probably benign Het
Synpo A G 18: 60,737,386 (GRCm39) S187P probably damaging Het
Thnsl1 T A 2: 21,216,856 (GRCm39) C203* probably null Het
Ttyh3 A T 5: 140,620,541 (GRCm39) I232N probably damaging Het
Upk1b T C 16: 38,607,604 (GRCm39) H41R probably benign Het
Vmn2r76 T C 7: 85,879,652 (GRCm39) D216G possibly damaging Het
Zan A T 5: 137,379,112 (GRCm39) C5329* probably null Het
Zbtb40 C T 4: 136,725,953 (GRCm39) M535I probably benign Het
Zfp383 A C 7: 29,614,263 (GRCm39) T173P possibly damaging Het
Zfp7 T A 15: 76,775,546 (GRCm39) C529* probably null Het
Other mutations in Igsf8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Igsf8 APN 1 172,145,111 (GRCm39) missense possibly damaging 0.48
IGL02090:Igsf8 APN 1 172,140,156 (GRCm39) intron probably benign
IGL02523:Igsf8 APN 1 172,146,980 (GRCm39) utr 3 prime probably benign
IGL03092:Igsf8 APN 1 172,140,096 (GRCm39) intron probably benign
IGL03184:Igsf8 APN 1 172,146,199 (GRCm39) missense probably damaging 0.96
R0398:Igsf8 UTSW 1 172,145,066 (GRCm39) missense probably damaging 1.00
R0468:Igsf8 UTSW 1 172,146,363 (GRCm39) missense probably damaging 1.00
R0494:Igsf8 UTSW 1 172,146,265 (GRCm39) missense probably benign 0.06
R0612:Igsf8 UTSW 1 172,146,974 (GRCm39) makesense probably null
R0613:Igsf8 UTSW 1 172,145,156 (GRCm39) missense probably benign 0.00
R0883:Igsf8 UTSW 1 172,143,826 (GRCm39) missense possibly damaging 0.67
R0941:Igsf8 UTSW 1 172,143,963 (GRCm39) missense probably damaging 1.00
R1689:Igsf8 UTSW 1 172,146,504 (GRCm39) missense probably damaging 0.99
R1706:Igsf8 UTSW 1 172,144,972 (GRCm39) missense probably damaging 1.00
R2050:Igsf8 UTSW 1 172,146,432 (GRCm39) missense probably damaging 1.00
R2182:Igsf8 UTSW 1 172,118,295 (GRCm39) critical splice donor site probably null
R3625:Igsf8 UTSW 1 172,145,336 (GRCm39) missense probably benign 0.18
R3833:Igsf8 UTSW 1 172,145,837 (GRCm39) missense probably benign 0.00
R4674:Igsf8 UTSW 1 172,146,479 (GRCm39) nonsense probably null
R6768:Igsf8 UTSW 1 172,145,099 (GRCm39) missense probably damaging 1.00
R7519:Igsf8 UTSW 1 172,143,874 (GRCm39) missense probably benign 0.38
R9515:Igsf8 UTSW 1 172,146,525 (GRCm39) missense
R9667:Igsf8 UTSW 1 172,145,319 (GRCm39) missense possibly damaging 0.95
Z1176:Igsf8 UTSW 1 172,145,921 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTTTACCCCACAGGAACCAGG -3'
(R):5'- AGAGCTCAGTACCTCTCAGC -3'

Sequencing Primer
(F):5'- CACAGGAACCAGGTGCTACG -3'
(R):5'- CACTGTAGTTGCCCAGGTAC -3'
Posted On 2016-02-04