Incidental Mutation 'R0418:Pdzd8'
ID 36902
Institutional Source Beutler Lab
Gene Symbol Pdzd8
Ensembl Gene ENSMUSG00000074746
Gene Name PDZ domain containing 8
Synonyms Pdzk8, A630041P07Rik
MMRRC Submission 038620-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0418 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 59285610-59334212 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 59289361 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 680 (R680C)
Ref Sequence ENSEMBL: ENSMUSP00000096880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026084] [ENSMUST00000099274]
AlphaFold B9EJ80
Predicted Effect probably benign
Transcript: ENSMUST00000026084
SMART Domains Protein: ENSMUSP00000026084
Gene: ENSMUSG00000025094

DomainStartEndE-ValueType
Pfam:MFS_1 22 428 6.8e-40 PFAM
Pfam:Sugar_tr 26 284 5.9e-10 PFAM
Pfam:MFS_2 127 457 4.3e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000099274
AA Change: R680C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096880
Gene: ENSMUSG00000074746
AA Change: R680C

DomainStartEndE-ValueType
transmembrane domain 2 24 N/A INTRINSIC
low complexity region 75 90 N/A INTRINSIC
PDZ 374 448 2.02e-10 SMART
low complexity region 582 596 N/A INTRINSIC
low complexity region 802 814 N/A INTRINSIC
C1 834 884 8.31e-8 SMART
coiled coil region 1021 1057 N/A INTRINSIC
Meta Mutation Damage Score 0.2728 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.2%
Validation Efficiency 98% (64/65)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930018P22Rik G T 2: 103,953,675 (GRCm39) probably null Het
Abca14 T C 7: 119,806,657 (GRCm39) L19P probably damaging Het
Abcb1a T A 5: 8,763,281 (GRCm39) V603E probably damaging Het
Acsl5 A G 19: 55,261,238 (GRCm39) D65G probably benign Het
Acss3 T C 10: 106,859,773 (GRCm39) Y311C probably damaging Het
Ak8 T G 2: 28,623,868 (GRCm39) I151S possibly damaging Het
Aldh1a1 T C 19: 20,606,413 (GRCm39) probably benign Het
Aldh1l1 A G 6: 90,546,875 (GRCm39) R393G possibly damaging Het
Ankhd1 T A 18: 36,767,353 (GRCm39) L1164Q probably damaging Het
Ascc3 G T 10: 50,625,022 (GRCm39) V1637L probably benign Het
Atf5 A G 7: 44,462,821 (GRCm39) M101T possibly damaging Het
Det1 T C 7: 78,493,765 (GRCm39) T80A probably benign Het
Dpp9 C T 17: 56,501,404 (GRCm39) probably benign Het
Fam13c A G 10: 70,370,591 (GRCm39) R244G probably damaging Het
Fat3 A T 9: 16,158,192 (GRCm39) N1139K probably damaging Het
Fbxo17 A G 7: 28,432,916 (GRCm39) T146A possibly damaging Het
Fli1 T C 9: 32,363,425 (GRCm39) probably benign Het
Glb1l2 T G 9: 26,705,397 (GRCm39) D151A probably damaging Het
Gli2 G A 1: 118,768,220 (GRCm39) T669I possibly damaging Het
Igsf3 C A 3: 101,342,751 (GRCm39) R463S probably damaging Het
Il1rl2 T C 1: 40,365,662 (GRCm39) V3A unknown Het
Irx3 G A 8: 92,526,708 (GRCm39) S332F probably benign Het
Katnb1 C T 8: 95,822,286 (GRCm39) T303M possibly damaging Het
Lrrc31 A T 3: 30,743,383 (GRCm39) L194Q probably damaging Het
Lrrc37a T G 11: 103,394,264 (GRCm39) E387A probably benign Het
Mapk14 T C 17: 28,910,763 (GRCm39) I17T probably benign Het
Mtif2 A G 11: 29,483,401 (GRCm39) probably benign Het
Myo16 A G 8: 10,619,918 (GRCm39) T1490A probably benign Het
Nfasc A G 1: 132,539,333 (GRCm39) V399A probably damaging Het
Nhsl3 A G 4: 129,117,477 (GRCm39) S396P probably damaging Het
Nobox T C 6: 43,284,169 (GRCm39) K1E probably null Het
Nr2c1 A T 10: 94,017,374 (GRCm39) M371L probably benign Het
Oplah C T 15: 76,182,687 (GRCm39) R924H probably benign Het
Or10ak16 C T 4: 118,750,448 (GRCm39) T56I possibly damaging Het
Or51a10 G A 7: 103,698,979 (GRCm39) T194I probably benign Het
Pappa2 C A 1: 158,544,560 (GRCm39) C1756F probably damaging Het
Rassf3 G A 10: 121,253,075 (GRCm39) T44M probably benign Het
Rmnd1 T C 10: 4,377,693 (GRCm39) probably null Het
Rnf126 C T 10: 79,598,477 (GRCm39) probably benign Het
Rnf144b T C 13: 47,397,966 (GRCm39) S299P probably benign Het
Ryr2 A G 13: 11,848,981 (GRCm39) probably benign Het
Scel T A 14: 103,840,690 (GRCm39) S511T probably benign Het
Slc16a10 G T 10: 39,916,627 (GRCm39) S138* probably null Het
Slc36a4 A T 9: 15,645,562 (GRCm39) I330F probably damaging Het
Slc5a8 A G 10: 88,722,420 (GRCm39) I84M probably benign Het
Spag9 T C 11: 93,982,579 (GRCm39) probably benign Het
Suco C T 1: 161,662,419 (GRCm39) V671I probably benign Het
Suox G A 10: 128,506,754 (GRCm39) P425S probably damaging Het
Tmem266 T A 9: 55,344,697 (GRCm39) V443E probably benign Het
Tmprss11f A T 5: 86,704,870 (GRCm39) I16N probably benign Het
Tnik T A 3: 28,625,029 (GRCm39) Y321* probably null Het
Tnrc6b T C 15: 80,797,524 (GRCm39) M1357T probably benign Het
Tpbg C A 9: 85,726,803 (GRCm39) Y257* probably null Het
Usp37 A T 1: 74,529,266 (GRCm39) S138T probably benign Het
Veph1 T A 3: 66,162,449 (GRCm39) R70* probably null Het
Vmn2r17 C T 5: 109,600,747 (GRCm39) P682S probably damaging Het
Vmn2r79 A C 7: 86,651,611 (GRCm39) N337H probably benign Het
Vstm2b A G 7: 40,551,876 (GRCm39) D68G probably damaging Het
Vwa7 G T 17: 35,236,933 (GRCm39) A167S possibly damaging Het
Zfp647 A T 15: 76,795,586 (GRCm39) I358N probably damaging Het
Zic2 CCCACCACCACCATCACCACCACCACC CCCACCATCACCACCACCACC 14: 122,713,776 (GRCm39) probably benign Het
Other mutations in Pdzd8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01293:Pdzd8 APN 19 59,288,218 (GRCm39) missense probably damaging 1.00
IGL01321:Pdzd8 APN 19 59,289,961 (GRCm39) missense probably benign
IGL01865:Pdzd8 APN 19 59,288,077 (GRCm39) missense possibly damaging 0.92
IGL02044:Pdzd8 APN 19 59,303,724 (GRCm39) missense possibly damaging 0.85
IGL02119:Pdzd8 APN 19 59,288,922 (GRCm39) missense possibly damaging 0.95
IGL02186:Pdzd8 APN 19 59,289,060 (GRCm39) missense probably damaging 1.00
IGL02389:Pdzd8 APN 19 59,289,825 (GRCm39) missense probably benign 0.00
IGL02479:Pdzd8 APN 19 59,288,215 (GRCm39) nonsense probably null
IGL02713:Pdzd8 APN 19 59,333,890 (GRCm39) missense probably damaging 0.98
IGL02958:Pdzd8 APN 19 59,288,804 (GRCm39) nonsense probably null
IGL02966:Pdzd8 APN 19 59,289,291 (GRCm39) missense probably damaging 1.00
IGL03166:Pdzd8 APN 19 59,288,940 (GRCm39) missense probably damaging 1.00
citadel UTSW 19 59,287,957 (GRCm39) makesense probably null
Eleventh_hour UTSW 19 59,293,662 (GRCm39) missense probably damaging 1.00
keep UTSW 19 59,289,783 (GRCm39) nonsense probably null
Stronghold UTSW 19 59,333,784 (GRCm39) nonsense probably null
R0018:Pdzd8 UTSW 19 59,289,105 (GRCm39) missense probably damaging 1.00
R0038:Pdzd8 UTSW 19 59,288,028 (GRCm39) missense possibly damaging 0.54
R0196:Pdzd8 UTSW 19 59,289,563 (GRCm39) missense probably benign 0.00
R0233:Pdzd8 UTSW 19 59,288,811 (GRCm39) missense probably damaging 0.99
R0233:Pdzd8 UTSW 19 59,288,811 (GRCm39) missense probably damaging 0.99
R0736:Pdzd8 UTSW 19 59,333,365 (GRCm39) missense probably damaging 0.99
R1456:Pdzd8 UTSW 19 59,288,904 (GRCm39) missense probably benign 0.01
R1709:Pdzd8 UTSW 19 59,289,771 (GRCm39) missense probably benign
R1965:Pdzd8 UTSW 19 59,288,554 (GRCm39) missense probably benign 0.37
R2155:Pdzd8 UTSW 19 59,288,853 (GRCm39) missense probably damaging 1.00
R3077:Pdzd8 UTSW 19 59,293,588 (GRCm39) critical splice donor site probably null
R3411:Pdzd8 UTSW 19 59,333,845 (GRCm39) missense probably damaging 1.00
R4345:Pdzd8 UTSW 19 59,288,560 (GRCm39) missense probably benign 0.00
R4354:Pdzd8 UTSW 19 59,333,913 (GRCm39) missense probably benign
R4504:Pdzd8 UTSW 19 59,333,880 (GRCm39) missense probably damaging 1.00
R4642:Pdzd8 UTSW 19 59,293,662 (GRCm39) missense probably damaging 1.00
R4705:Pdzd8 UTSW 19 59,333,743 (GRCm39) missense possibly damaging 0.80
R4773:Pdzd8 UTSW 19 59,289,292 (GRCm39) missense probably damaging 1.00
R4876:Pdzd8 UTSW 19 59,289,236 (GRCm39) nonsense probably null
R5176:Pdzd8 UTSW 19 59,333,389 (GRCm39) missense probably damaging 1.00
R5267:Pdzd8 UTSW 19 59,289,458 (GRCm39) missense probably damaging 1.00
R5707:Pdzd8 UTSW 19 59,288,057 (GRCm39) missense probably benign 0.00
R5766:Pdzd8 UTSW 19 59,288,972 (GRCm39) missense possibly damaging 0.65
R5903:Pdzd8 UTSW 19 59,333,718 (GRCm39) missense possibly damaging 0.58
R6036:Pdzd8 UTSW 19 59,293,641 (GRCm39) missense probably damaging 1.00
R6036:Pdzd8 UTSW 19 59,293,641 (GRCm39) missense probably damaging 1.00
R6238:Pdzd8 UTSW 19 59,288,994 (GRCm39) missense probably benign 0.05
R6360:Pdzd8 UTSW 19 59,289,415 (GRCm39) missense probably benign 0.10
R6509:Pdzd8 UTSW 19 59,333,298 (GRCm39) missense probably benign 0.01
R6674:Pdzd8 UTSW 19 59,289,801 (GRCm39) missense probably damaging 1.00
R6808:Pdzd8 UTSW 19 59,287,957 (GRCm39) makesense probably null
R6902:Pdzd8 UTSW 19 59,289,829 (GRCm39) missense possibly damaging 0.91
R7017:Pdzd8 UTSW 19 59,333,784 (GRCm39) nonsense probably null
R7088:Pdzd8 UTSW 19 59,333,389 (GRCm39) missense probably damaging 1.00
R7116:Pdzd8 UTSW 19 59,288,125 (GRCm39) missense probably damaging 1.00
R7158:Pdzd8 UTSW 19 59,288,589 (GRCm39) missense probably damaging 1.00
R7237:Pdzd8 UTSW 19 59,333,571 (GRCm39) missense probably damaging 1.00
R7251:Pdzd8 UTSW 19 59,289,077 (GRCm39) missense possibly damaging 0.96
R7314:Pdzd8 UTSW 19 59,289,783 (GRCm39) nonsense probably null
R7699:Pdzd8 UTSW 19 59,333,373 (GRCm39) missense probably damaging 1.00
R7751:Pdzd8 UTSW 19 59,333,208 (GRCm39) missense probably damaging 0.98
R7759:Pdzd8 UTSW 19 59,288,358 (GRCm39) missense probably damaging 1.00
R7784:Pdzd8 UTSW 19 59,316,295 (GRCm39) missense probably damaging 1.00
R7917:Pdzd8 UTSW 19 59,333,518 (GRCm39) missense probably damaging 0.96
R9364:Pdzd8 UTSW 19 59,333,574 (GRCm39) missense probably damaging 1.00
R9368:Pdzd8 UTSW 19 59,289,219 (GRCm39) nonsense probably null
R9406:Pdzd8 UTSW 19 59,333,245 (GRCm39) missense
R9548:Pdzd8 UTSW 19 59,289,826 (GRCm39) missense probably benign 0.13
R9554:Pdzd8 UTSW 19 59,333,574 (GRCm39) missense probably damaging 1.00
R9688:Pdzd8 UTSW 19 59,333,683 (GRCm39) missense probably benign 0.05
R9750:Pdzd8 UTSW 19 59,289,684 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGGAGTGTAGAAACCTCCTCAACC -3'
(R):5'- TGCAGATAAACCTGCCGAGAAGC -3'

Sequencing Primer
(F):5'- ACGTAGTGCAGTTCTAGTGACC -3'
(R):5'- CCTGCCGAGAAGCAAGTG -3'
Posted On 2013-05-09