Incidental Mutation 'R0418:Pdzd8'
ID36902
Institutional Source Beutler Lab
Gene Symbol Pdzd8
Ensembl Gene ENSMUSG00000074746
Gene NamePDZ domain containing 8
SynonymsA630041P07Rik, Pdzk8
MMRRC Submission 038620-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0418 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location59296084-59345780 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 59300929 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 680 (R680C)
Ref Sequence ENSEMBL: ENSMUSP00000096880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026084] [ENSMUST00000099274]
Predicted Effect probably benign
Transcript: ENSMUST00000026084
SMART Domains Protein: ENSMUSP00000026084
Gene: ENSMUSG00000025094

DomainStartEndE-ValueType
Pfam:MFS_1 22 428 6.8e-40 PFAM
Pfam:Sugar_tr 26 284 5.9e-10 PFAM
Pfam:MFS_2 127 457 4.3e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000099274
AA Change: R680C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096880
Gene: ENSMUSG00000074746
AA Change: R680C

DomainStartEndE-ValueType
transmembrane domain 2 24 N/A INTRINSIC
low complexity region 75 90 N/A INTRINSIC
PDZ 374 448 2.02e-10 SMART
low complexity region 582 596 N/A INTRINSIC
low complexity region 802 814 N/A INTRINSIC
C1 834 884 8.31e-8 SMART
coiled coil region 1021 1057 N/A INTRINSIC
Meta Mutation Damage Score 0.196 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.2%
Validation Efficiency 98% (64/65)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930018P22Rik G T 2: 104,123,330 probably null Het
Abca14 T C 7: 120,207,434 L19P probably damaging Het
Abcb1a T A 5: 8,713,281 V603E probably damaging Het
Acsl5 A G 19: 55,272,806 D65G probably benign Het
Acss3 T C 10: 107,023,912 Y311C probably damaging Het
Ak8 T G 2: 28,733,856 I151S possibly damaging Het
Aldh1a1 T C 19: 20,629,049 probably benign Het
Aldh1l1 A G 6: 90,569,893 R393G possibly damaging Het
Ankhd1 T A 18: 36,634,300 L1164Q probably damaging Het
Ascc3 G T 10: 50,748,926 V1637L probably benign Het
Atf5 A G 7: 44,813,397 M101T possibly damaging Het
C77080 A G 4: 129,223,684 S396P probably damaging Het
Det1 T C 7: 78,844,017 T80A probably benign Het
Dpp9 C T 17: 56,194,404 probably benign Het
Fam13c A G 10: 70,534,761 R244G probably damaging Het
Fat3 A T 9: 16,246,896 N1139K probably damaging Het
Fbxo17 A G 7: 28,733,491 T146A possibly damaging Het
Fli1 T C 9: 32,452,129 probably benign Het
Glb1l2 T G 9: 26,794,101 D151A probably damaging Het
Gli2 G A 1: 118,840,490 T669I possibly damaging Het
Igsf3 C A 3: 101,435,435 R463S probably damaging Het
Il1rl2 T C 1: 40,326,502 V3A unknown Het
Irx3 G A 8: 91,800,080 S332F probably benign Het
Katnb1 C T 8: 95,095,658 T303M possibly damaging Het
Lrrc31 A T 3: 30,689,234 L194Q probably damaging Het
Lrrc37a T G 11: 103,503,438 E387A probably benign Het
Mapk14 T C 17: 28,691,789 I17T probably benign Het
Mtif2 A G 11: 29,533,401 probably benign Het
Myo16 A G 8: 10,569,918 T1490A probably benign Het
Nfasc A G 1: 132,611,595 V399A probably damaging Het
Nobox T C 6: 43,307,235 K1E probably null Het
Nr2c1 A T 10: 94,181,512 M371L probably benign Het
Olfr1330 C T 4: 118,893,251 T56I possibly damaging Het
Olfr642 G A 7: 104,049,772 T194I probably benign Het
Oplah C T 15: 76,298,487 R924H probably benign Het
Pappa2 C A 1: 158,716,990 C1756F probably damaging Het
Rassf3 G A 10: 121,417,170 T44M probably benign Het
Rmnd1 T C 10: 4,427,693 probably null Het
Rnf126 C T 10: 79,762,643 probably benign Het
Rnf144b T C 13: 47,244,490 S299P probably benign Het
Ryr2 A G 13: 11,834,095 probably benign Het
Scel T A 14: 103,603,254 S511T probably benign Het
Slc16a10 G T 10: 40,040,631 S138* probably null Het
Slc36a4 A T 9: 15,734,266 I330F probably damaging Het
Slc5a8 A G 10: 88,886,558 I84M probably benign Het
Spag9 T C 11: 94,091,753 probably benign Het
Suco C T 1: 161,834,850 V671I probably benign Het
Suox G A 10: 128,670,885 P425S probably damaging Het
Tmem266 T A 9: 55,437,413 V443E probably benign Het
Tmprss11f A T 5: 86,557,011 I16N probably benign Het
Tnik T A 3: 28,570,880 Y321* probably null Het
Tnrc6b T C 15: 80,913,323 M1357T probably benign Het
Tpbg C A 9: 85,844,750 Y257* probably null Het
Usp37 A T 1: 74,490,107 S138T probably benign Het
Veph1 T A 3: 66,255,028 R70* probably null Het
Vmn2r17 C T 5: 109,452,881 P682S probably damaging Het
Vmn2r79 A C 7: 87,002,403 N337H probably benign Het
Vstm2b A G 7: 40,902,452 D68G probably damaging Het
Vwa7 G T 17: 35,017,957 A167S possibly damaging Het
Zfp647 A T 15: 76,911,386 I358N probably damaging Het
Zic2 CCCACCACCACCATCACCACCACCACC CCCACCATCACCACCACCACC 14: 122,476,364 probably benign Het
Other mutations in Pdzd8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01293:Pdzd8 APN 19 59299786 missense probably damaging 1.00
IGL01321:Pdzd8 APN 19 59301529 missense probably benign
IGL01865:Pdzd8 APN 19 59299645 missense possibly damaging 0.92
IGL02044:Pdzd8 APN 19 59315292 missense possibly damaging 0.85
IGL02119:Pdzd8 APN 19 59300490 missense possibly damaging 0.95
IGL02186:Pdzd8 APN 19 59300628 missense probably damaging 1.00
IGL02389:Pdzd8 APN 19 59301393 missense probably benign 0.00
IGL02479:Pdzd8 APN 19 59299783 nonsense probably null
IGL02713:Pdzd8 APN 19 59345458 missense probably damaging 0.98
IGL02958:Pdzd8 APN 19 59300372 nonsense probably null
IGL02966:Pdzd8 APN 19 59300859 missense probably damaging 1.00
IGL03166:Pdzd8 APN 19 59300508 missense probably damaging 1.00
citadel UTSW 19 59299525 makesense probably null
eleventh_hour UTSW 19 59305230 missense probably damaging 1.00
stronghold UTSW 19 59345352 nonsense probably null
R0018:Pdzd8 UTSW 19 59300673 missense probably damaging 1.00
R0038:Pdzd8 UTSW 19 59299596 missense possibly damaging 0.54
R0196:Pdzd8 UTSW 19 59301131 missense probably benign 0.00
R0233:Pdzd8 UTSW 19 59300379 missense probably damaging 0.99
R0233:Pdzd8 UTSW 19 59300379 missense probably damaging 0.99
R0736:Pdzd8 UTSW 19 59344933 missense probably damaging 0.99
R1456:Pdzd8 UTSW 19 59300472 missense probably benign 0.01
R1709:Pdzd8 UTSW 19 59301339 missense probably benign
R1965:Pdzd8 UTSW 19 59300122 missense probably benign 0.37
R2155:Pdzd8 UTSW 19 59300421 missense probably damaging 1.00
R3077:Pdzd8 UTSW 19 59305156 critical splice donor site probably null
R3411:Pdzd8 UTSW 19 59345413 missense probably damaging 1.00
R4345:Pdzd8 UTSW 19 59300128 missense probably benign 0.00
R4354:Pdzd8 UTSW 19 59345481 missense probably benign
R4504:Pdzd8 UTSW 19 59345448 missense probably damaging 1.00
R4642:Pdzd8 UTSW 19 59305230 missense probably damaging 1.00
R4705:Pdzd8 UTSW 19 59345311 missense possibly damaging 0.80
R4773:Pdzd8 UTSW 19 59300860 missense probably damaging 1.00
R4876:Pdzd8 UTSW 19 59300804 nonsense probably null
R5176:Pdzd8 UTSW 19 59344957 missense probably damaging 1.00
R5267:Pdzd8 UTSW 19 59301026 missense probably damaging 1.00
R5707:Pdzd8 UTSW 19 59299625 missense probably benign 0.00
R5766:Pdzd8 UTSW 19 59300540 missense possibly damaging 0.65
R5903:Pdzd8 UTSW 19 59345286 missense possibly damaging 0.58
R6036:Pdzd8 UTSW 19 59305209 missense probably damaging 1.00
R6036:Pdzd8 UTSW 19 59305209 missense probably damaging 1.00
R6238:Pdzd8 UTSW 19 59300562 missense probably benign 0.05
R6360:Pdzd8 UTSW 19 59300983 missense probably benign 0.10
R6509:Pdzd8 UTSW 19 59344866 missense probably benign 0.01
R6674:Pdzd8 UTSW 19 59301369 missense probably damaging 1.00
R6808:Pdzd8 UTSW 19 59299525 makesense probably null
R6902:Pdzd8 UTSW 19 59301397 missense possibly damaging 0.91
R7017:Pdzd8 UTSW 19 59345352 nonsense probably null
R7088:Pdzd8 UTSW 19 59344957 missense probably damaging 1.00
R7116:Pdzd8 UTSW 19 59299693 missense probably damaging 1.00
R7158:Pdzd8 UTSW 19 59300157 missense probably damaging 1.00
R7237:Pdzd8 UTSW 19 59345139 missense probably damaging 1.00
R7251:Pdzd8 UTSW 19 59300645 missense possibly damaging 0.96
R7314:Pdzd8 UTSW 19 59301351 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGGGAGTGTAGAAACCTCCTCAACC -3'
(R):5'- TGCAGATAAACCTGCCGAGAAGC -3'

Sequencing Primer
(F):5'- ACGTAGTGCAGTTCTAGTGACC -3'
(R):5'- CCTGCCGAGAAGCAAGTG -3'
Posted On2013-05-09