Incidental Mutation 'R4796:Prex1'
ID 369024
Institutional Source Beutler Lab
Gene Symbol Prex1
Ensembl Gene ENSMUSG00000039621
Gene Name phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1
Synonyms P-REX1
Accession Numbers
Essential gene? Probably non essential (E-score: 0.188) question?
Stock # R4796 (G1)
Quality Score 181
Status Not validated
Chromosome 2
Chromosomal Location 166408265-166555752 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 166434211 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 503 (L503Q)
Ref Sequence ENSEMBL: ENSMUSP00000096679 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036719] [ENSMUST00000099080]
AlphaFold Q69ZK0
Predicted Effect probably damaging
Transcript: ENSMUST00000036719
AA Change: L673Q

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000037180
Gene: ENSMUSG00000039621
AA Change: L673Q

DomainStartEndE-ValueType
low complexity region 3 27 N/A INTRINSIC
RhoGEF 48 234 3.16e-52 SMART
PH 267 389 1.02e-10 SMART
DEP 418 491 6.86e-27 SMART
DEP 519 592 3.06e-24 SMART
PDZ 628 701 4.55e-1 SMART
PDZ 712 783 5.66e-1 SMART
low complexity region 800 811 N/A INTRINSIC
low complexity region 814 825 N/A INTRINSIC
low complexity region 1109 1127 N/A INTRINSIC
low complexity region 1545 1555 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000099080
AA Change: L503Q

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000096679
Gene: ENSMUSG00000039621
AA Change: L503Q

DomainStartEndE-ValueType
Pfam:RhoGEF 5 64 3.8e-18 PFAM
PH 97 219 1.02e-10 SMART
DEP 248 321 6.86e-27 SMART
DEP 349 422 3.06e-24 SMART
PDZ 458 531 4.55e-1 SMART
PDZ 542 613 5.66e-1 SMART
low complexity region 630 641 N/A INTRINSIC
low complexity region 644 655 N/A INTRINSIC
low complexity region 939 957 N/A INTRINSIC
low complexity region 1375 1385 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene acts as a guanine nucleotide exchange factor for the RHO family of small GTP-binding proteins (RACs). It has been shown to bind to and activate RAC1 by exchanging bound GDP for free GTP. The encoded protein, which is found mainly in the cytoplasm, is activated by phosphatidylinositol-3,4,5-trisphosphate and the beta-gamma subunits of heterotrimeric G proteins. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele have impaired neutrophil migration and autism-like social behavior with defective AMPA-mediated LTD. Mice with other alleles exhibit reduced weight, smaller livers and increased peripheral neutrophil numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 C T 13: 81,303,350 (GRCm39) W132* probably null Het
Atp8b3 A G 10: 80,360,188 (GRCm39) V961A probably damaging Het
Bglap A C 3: 88,291,712 (GRCm39) I4S unknown Het
Bmp1 T C 14: 70,729,513 (GRCm39) probably null Het
Brd10 G A 19: 29,731,018 (GRCm39) H665Y probably benign Het
Btaf1 T C 19: 36,933,828 (GRCm39) L152P possibly damaging Het
Cacna1b T A 2: 24,527,499 (GRCm39) T1621S possibly damaging Het
Capn3 A T 2: 120,333,479 (GRCm39) N621I probably damaging Het
Ccdc121rt3 A G 5: 112,503,165 (GRCm39) S180P possibly damaging Het
Ccdc59 T C 10: 105,677,429 (GRCm39) S23P probably benign Het
Cd22 A T 7: 30,572,381 (GRCm39) probably null Het
Cdh20 A G 1: 104,868,989 (GRCm39) D160G probably damaging Het
Cep112 T C 11: 108,377,818 (GRCm39) probably null Het
Clock T C 5: 76,413,763 (GRCm39) K44R probably damaging Het
Coq10b A G 1: 55,110,957 (GRCm39) T242A probably damaging Het
Cstdc2 A G 2: 148,692,658 (GRCm39) F48S probably damaging Het
Ctnnd1 G T 2: 84,450,270 (GRCm39) R317S probably damaging Het
Dlg5 G A 14: 24,194,451 (GRCm39) H1674Y probably damaging Het
Drc3 C A 11: 60,254,354 (GRCm39) N75K probably damaging Het
Efna4 T C 3: 89,242,555 (GRCm39) E113G probably damaging Het
Egr3 C A 14: 70,315,024 (GRCm39) A44D probably benign Het
Ercc3 T C 18: 32,381,363 (GRCm39) F393S probably damaging Het
Evi2 T A 11: 79,406,273 (GRCm39) probably benign Het
Fam78b T C 1: 166,906,216 (GRCm39) V125A probably benign Het
Fars2 A T 13: 36,721,400 (GRCm39) E448V probably damaging Het
Farsb A T 1: 78,401,833 (GRCm39) *590R probably null Het
Fat3 A G 9: 15,911,028 (GRCm39) M1658T probably benign Het
Fhod3 G T 18: 25,118,358 (GRCm39) V232F probably damaging Het
Fkbpl G A 17: 34,864,303 (GRCm39) A24T probably benign Het
Fzd3 A G 14: 65,472,607 (GRCm39) V387A possibly damaging Het
Gm1527 A G 3: 28,974,812 (GRCm39) I542V possibly damaging Het
Gm7964 A G 7: 83,405,109 (GRCm39) probably null Het
Hbs1l G T 10: 21,218,405 (GRCm39) G301C probably damaging Het
Hipk4 A G 7: 27,227,995 (GRCm39) H247R probably benign Het
Hmcn1 A G 1: 150,629,362 (GRCm39) V965A probably benign Het
Hoxa5 C T 6: 52,180,943 (GRCm39) A130T probably benign Het
Igf2r C T 17: 12,903,013 (GRCm39) V2346I possibly damaging Het
Igsf8 T C 1: 172,143,889 (GRCm39) V14A probably benign Het
Impg1 G A 9: 80,301,377 (GRCm39) P183L probably damaging Het
Isl1 T C 13: 116,441,966 (GRCm39) N89S probably benign Het
Itga1 C A 13: 115,171,921 (GRCm39) W61C probably damaging Het
Itga5 T C 15: 103,256,187 (GRCm39) R922G probably benign Het
Itgb5 T C 16: 33,705,391 (GRCm39) V227A possibly damaging Het
Jph4 G T 14: 55,347,165 (GRCm39) P461T probably damaging Het
Kcnab1 T A 3: 65,211,586 (GRCm39) probably null Het
Klrc1 T A 6: 129,654,725 (GRCm39) probably null Het
Lonrf2 A T 1: 38,855,119 (GRCm39) L92Q probably benign Het
Ly75 T C 2: 60,180,284 (GRCm39) E631G probably benign Het
Mapk13 T C 17: 28,994,528 (GRCm39) Y140H probably damaging Het
Meak7 A T 8: 120,495,093 (GRCm39) S222T probably benign Het
Mgat4d A G 8: 84,084,749 (GRCm39) E164G probably damaging Het
Mrtfa C T 15: 80,901,234 (GRCm39) S419N probably damaging Het
Mtcl2 A G 2: 156,862,172 (GRCm39) S1586P probably benign Het
Mthfs A T 9: 89,122,078 (GRCm39) H188L probably benign Het
Muc5b T A 7: 141,417,983 (GRCm39) M3643K possibly damaging Het
Mylk3 T C 8: 86,077,014 (GRCm39) Y474C probably damaging Het
Myo5b A G 18: 74,877,701 (GRCm39) T1567A possibly damaging Het
Ncaph2 T G 15: 89,255,010 (GRCm39) V478G probably damaging Het
Ncbp1 A G 4: 46,152,967 (GRCm39) R247G possibly damaging Het
Nedd9 T C 13: 41,471,376 (GRCm39) K208E probably benign Het
Nxph2 C T 2: 23,289,870 (GRCm39) T74M probably benign Het
Ogdh T A 11: 6,290,570 (GRCm39) M385K probably benign Het
Or10a5 A T 7: 106,636,121 (GRCm39) Y253F probably benign Het
Or3a1c A T 11: 74,046,417 (GRCm39) I146F probably benign Het
Or4a2 T C 2: 89,248,235 (GRCm39) H174R probably damaging Het
Or6a2 C T 7: 106,600,542 (GRCm39) G175D probably damaging Het
Or7g18 T C 9: 18,787,475 (GRCm39) V284A probably damaging Het
Or8b54 T A 9: 38,686,670 (GRCm39) F40I probably benign Het
Pcsk2 A C 2: 143,655,345 (GRCm39) I510L probably benign Het
Pdgfra A G 5: 75,349,972 (GRCm39) N952S probably benign Het
Pex26 T C 6: 121,170,516 (GRCm39) F287S probably damaging Het
Pick1 G C 15: 79,139,810 (GRCm39) probably benign Het
Plxnb1 G T 9: 108,943,663 (GRCm39) V1917L probably damaging Het
Polk T C 13: 96,625,764 (GRCm39) T347A probably benign Het
Ppp1r10 T G 17: 36,234,979 (GRCm39) I61R probably damaging Het
Ptp4a1 A C 1: 30,983,019 (GRCm39) I133R probably damaging Het
Rassf10 G T 7: 112,553,735 (GRCm39) R112L probably damaging Het
Ripor3 T A 2: 167,823,260 (GRCm39) I884F probably damaging Het
Rnft2 A G 5: 118,339,311 (GRCm39) Y369H probably damaging Het
Rtp3 A T 9: 110,815,522 (GRCm39) V281E probably benign Het
Runx1t1 T A 4: 13,837,767 (GRCm39) N51K probably damaging Het
Selp A G 1: 163,972,475 (GRCm39) T705A probably benign Het
Sgca A T 11: 94,861,553 (GRCm39) probably null Het
Slc22a3 T C 17: 12,642,675 (GRCm39) E514G probably damaging Het
Slc28a2b T A 2: 122,344,940 (GRCm39) I182N probably damaging Het
Slc2a1 G A 4: 118,989,642 (GRCm39) R61Q probably damaging Het
Smarcal1 G A 1: 72,636,599 (GRCm39) V425I probably benign Het
Ssx2ip T C 3: 146,124,114 (GRCm39) V43A probably benign Het
Synpo A G 18: 60,737,386 (GRCm39) S187P probably damaging Het
Thnsl1 T A 2: 21,216,856 (GRCm39) C203* probably null Het
Ttyh3 A T 5: 140,620,541 (GRCm39) I232N probably damaging Het
Upk1b T C 16: 38,607,604 (GRCm39) H41R probably benign Het
Vmn2r76 T C 7: 85,879,652 (GRCm39) D216G possibly damaging Het
Zan A T 5: 137,379,112 (GRCm39) C5329* probably null Het
Zbtb40 C T 4: 136,725,953 (GRCm39) M535I probably benign Het
Zfp383 A C 7: 29,614,263 (GRCm39) T173P possibly damaging Het
Zfp7 T A 15: 76,775,546 (GRCm39) C529* probably null Het
Other mutations in Prex1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Prex1 APN 2 166,480,321 (GRCm39) missense probably damaging 1.00
IGL00309:Prex1 APN 2 166,451,743 (GRCm39) missense probably damaging 0.99
IGL00953:Prex1 APN 2 166,480,329 (GRCm39) missense probably damaging 1.00
IGL00961:Prex1 APN 2 166,427,656 (GRCm39) missense probably damaging 0.98
IGL01300:Prex1 APN 2 166,480,327 (GRCm39) missense possibly damaging 0.46
IGL01318:Prex1 APN 2 166,411,260 (GRCm39) splice site probably benign
IGL01753:Prex1 APN 2 166,444,802 (GRCm39) missense probably benign 0.11
IGL01819:Prex1 APN 2 166,463,165 (GRCm39) missense probably damaging 1.00
IGL02058:Prex1 APN 2 166,427,103 (GRCm39) missense probably benign 0.00
IGL02251:Prex1 APN 2 166,419,806 (GRCm39) missense probably damaging 0.99
IGL02326:Prex1 APN 2 166,463,105 (GRCm39) missense probably benign 0.35
IGL02366:Prex1 APN 2 166,422,347 (GRCm39) missense probably damaging 1.00
IGL02414:Prex1 APN 2 166,451,748 (GRCm39) missense probably damaging 1.00
IGL02660:Prex1 APN 2 166,435,787 (GRCm39) missense probably damaging 0.97
IGL02666:Prex1 APN 2 166,414,909 (GRCm39) missense probably benign 0.00
IGL02874:Prex1 APN 2 166,426,967 (GRCm39) missense probably damaging 1.00
IGL02935:Prex1 APN 2 166,412,265 (GRCm39) missense probably damaging 1.00
IGL03179:Prex1 APN 2 166,427,114 (GRCm39) missense probably benign 0.31
R0207:Prex1 UTSW 2 166,427,818 (GRCm39) missense possibly damaging 0.92
R0415:Prex1 UTSW 2 166,428,619 (GRCm39) unclassified probably benign
R0420:Prex1 UTSW 2 166,431,491 (GRCm39) missense probably benign 0.13
R0449:Prex1 UTSW 2 166,411,297 (GRCm39) missense probably benign 0.16
R0458:Prex1 UTSW 2 166,427,743 (GRCm39) missense probably damaging 0.99
R0927:Prex1 UTSW 2 166,428,457 (GRCm39) missense probably benign 0.01
R1299:Prex1 UTSW 2 166,427,827 (GRCm39) missense possibly damaging 0.62
R1414:Prex1 UTSW 2 166,435,781 (GRCm39) missense probably damaging 1.00
R1440:Prex1 UTSW 2 166,422,383 (GRCm39) missense probably damaging 0.98
R1506:Prex1 UTSW 2 166,429,001 (GRCm39) missense probably damaging 1.00
R1725:Prex1 UTSW 2 166,443,656 (GRCm39) missense probably damaging 1.00
R1831:Prex1 UTSW 2 166,427,021 (GRCm39) missense probably damaging 1.00
R1883:Prex1 UTSW 2 166,425,192 (GRCm39) missense probably benign 0.20
R1896:Prex1 UTSW 2 166,428,574 (GRCm39) missense probably benign 0.01
R2022:Prex1 UTSW 2 166,417,534 (GRCm39) missense possibly damaging 0.80
R2091:Prex1 UTSW 2 166,411,285 (GRCm39) missense possibly damaging 0.95
R2258:Prex1 UTSW 2 166,429,077 (GRCm39) missense probably benign 0.00
R2263:Prex1 UTSW 2 166,430,988 (GRCm39) splice site probably benign
R2276:Prex1 UTSW 2 166,419,875 (GRCm39) missense probably benign 0.34
R2279:Prex1 UTSW 2 166,419,875 (GRCm39) missense probably benign 0.34
R2680:Prex1 UTSW 2 166,443,692 (GRCm39) missense possibly damaging 0.92
R3024:Prex1 UTSW 2 166,430,956 (GRCm39) missense probably benign 0.04
R3421:Prex1 UTSW 2 166,459,774 (GRCm39) missense probably damaging 1.00
R3614:Prex1 UTSW 2 166,451,701 (GRCm39) missense probably damaging 1.00
R4244:Prex1 UTSW 2 166,412,256 (GRCm39) missense probably damaging 1.00
R4605:Prex1 UTSW 2 166,555,464 (GRCm39) missense probably benign 0.45
R4685:Prex1 UTSW 2 166,480,252 (GRCm39) missense probably damaging 0.97
R4787:Prex1 UTSW 2 166,480,260 (GRCm39) missense probably benign 0.01
R4825:Prex1 UTSW 2 166,427,777 (GRCm39) nonsense probably null
R4955:Prex1 UTSW 2 166,415,143 (GRCm39) missense probably damaging 0.99
R5046:Prex1 UTSW 2 166,414,883 (GRCm39) missense probably benign 0.00
R5095:Prex1 UTSW 2 166,423,841 (GRCm39) missense probably damaging 1.00
R5408:Prex1 UTSW 2 166,417,573 (GRCm39) small insertion probably benign
R5462:Prex1 UTSW 2 166,486,728 (GRCm39) missense probably benign 0.02
R5535:Prex1 UTSW 2 166,422,193 (GRCm39) missense possibly damaging 0.80
R5777:Prex1 UTSW 2 166,428,579 (GRCm39) missense probably damaging 1.00
R5813:Prex1 UTSW 2 166,425,127 (GRCm39) missense probably benign
R5860:Prex1 UTSW 2 166,486,604 (GRCm39) intron probably benign
R5984:Prex1 UTSW 2 166,427,664 (GRCm39) missense probably damaging 1.00
R6009:Prex1 UTSW 2 166,423,904 (GRCm39) missense probably damaging 1.00
R6174:Prex1 UTSW 2 166,414,883 (GRCm39) missense probably benign 0.00
R6345:Prex1 UTSW 2 166,414,880 (GRCm39) missense probably null 0.81
R6897:Prex1 UTSW 2 166,423,913 (GRCm39) missense probably damaging 0.99
R6935:Prex1 UTSW 2 166,441,575 (GRCm39) missense probably damaging 1.00
R7025:Prex1 UTSW 2 166,455,107 (GRCm39) small insertion probably benign
R7037:Prex1 UTSW 2 166,429,100 (GRCm39) missense probably benign 0.05
R7076:Prex1 UTSW 2 166,475,302 (GRCm39) missense probably damaging 0.99
R7181:Prex1 UTSW 2 166,412,291 (GRCm39) missense probably damaging 1.00
R7361:Prex1 UTSW 2 166,555,490 (GRCm39) missense probably benign 0.04
R7381:Prex1 UTSW 2 166,429,047 (GRCm39) missense probably damaging 1.00
R7721:Prex1 UTSW 2 166,419,810 (GRCm39) nonsense probably null
R7763:Prex1 UTSW 2 166,555,629 (GRCm39) missense unknown
R7809:Prex1 UTSW 2 166,415,164 (GRCm39) missense possibly damaging 0.91
R7915:Prex1 UTSW 2 166,463,112 (GRCm39) missense probably damaging 1.00
R7971:Prex1 UTSW 2 166,423,859 (GRCm39) missense probably damaging 1.00
R7998:Prex1 UTSW 2 166,428,965 (GRCm39) critical splice donor site probably null
R8029:Prex1 UTSW 2 166,417,523 (GRCm39) missense probably benign 0.01
R8193:Prex1 UTSW 2 166,435,780 (GRCm39) missense possibly damaging 0.60
R8352:Prex1 UTSW 2 166,431,493 (GRCm39) missense probably benign 0.05
R8452:Prex1 UTSW 2 166,431,493 (GRCm39) missense probably benign 0.05
R8927:Prex1 UTSW 2 166,426,995 (GRCm39) missense probably damaging 0.97
R8928:Prex1 UTSW 2 166,426,995 (GRCm39) missense probably damaging 0.97
R9021:Prex1 UTSW 2 166,432,429 (GRCm39) missense possibly damaging 0.47
R9070:Prex1 UTSW 2 166,427,707 (GRCm39) missense probably damaging 1.00
R9213:Prex1 UTSW 2 166,417,669 (GRCm39) missense probably damaging 0.99
R9511:Prex1 UTSW 2 166,413,481 (GRCm39) missense probably damaging 1.00
R9514:Prex1 UTSW 2 166,419,896 (GRCm39) missense possibly damaging 0.53
R9529:Prex1 UTSW 2 166,431,518 (GRCm39) missense probably damaging 1.00
X0065:Prex1 UTSW 2 166,428,545 (GRCm39) missense probably benign
Z1176:Prex1 UTSW 2 166,414,890 (GRCm39) nonsense probably null
Z1177:Prex1 UTSW 2 166,434,148 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTGGTCATGCACTTGGGACATC -3'
(R):5'- GCTGGCCATTTCTTCCCAAG -3'

Sequencing Primer
(F):5'- GCACTTGGGACATCAAATTAGAC -3'
(R):5'- TCCCAAGGGAACTGCCAC -3'
Posted On 2016-02-04