Incidental Mutation 'R4796:Vmn2r76'
ID 369050
Institutional Source Beutler Lab
Gene Symbol Vmn2r76
Ensembl Gene ENSMUSG00000091239
Gene Name vomeronasal 2, receptor 76
Synonyms
Accession Numbers
Essential gene? Probably non essential (E-score: 0.166) question?
Stock # R4796 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 85874414-85895409 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 85879652 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 216 (D216G)
Ref Sequence ENSEMBL: ENSMUSP00000127309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165771]
AlphaFold E9Q3F5
Predicted Effect possibly damaging
Transcript: ENSMUST00000165771
AA Change: D216G

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000127309
Gene: ENSMUSG00000091239
AA Change: D216G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 78 470 1.2e-29 PFAM
low complexity region 476 489 N/A INTRINSIC
Pfam:NCD3G 513 565 3.7e-22 PFAM
Pfam:7tm_3 598 833 1.4e-52 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 C T 13: 81,303,350 (GRCm39) W132* probably null Het
Atp8b3 A G 10: 80,360,188 (GRCm39) V961A probably damaging Het
Bglap A C 3: 88,291,712 (GRCm39) I4S unknown Het
Bmp1 T C 14: 70,729,513 (GRCm39) probably null Het
Brd10 G A 19: 29,731,018 (GRCm39) H665Y probably benign Het
Btaf1 T C 19: 36,933,828 (GRCm39) L152P possibly damaging Het
Cacna1b T A 2: 24,527,499 (GRCm39) T1621S possibly damaging Het
Capn3 A T 2: 120,333,479 (GRCm39) N621I probably damaging Het
Ccdc121rt3 A G 5: 112,503,165 (GRCm39) S180P possibly damaging Het
Ccdc59 T C 10: 105,677,429 (GRCm39) S23P probably benign Het
Cd22 A T 7: 30,572,381 (GRCm39) probably null Het
Cdh20 A G 1: 104,868,989 (GRCm39) D160G probably damaging Het
Cep112 T C 11: 108,377,818 (GRCm39) probably null Het
Clock T C 5: 76,413,763 (GRCm39) K44R probably damaging Het
Coq10b A G 1: 55,110,957 (GRCm39) T242A probably damaging Het
Cstdc2 A G 2: 148,692,658 (GRCm39) F48S probably damaging Het
Ctnnd1 G T 2: 84,450,270 (GRCm39) R317S probably damaging Het
Dlg5 G A 14: 24,194,451 (GRCm39) H1674Y probably damaging Het
Drc3 C A 11: 60,254,354 (GRCm39) N75K probably damaging Het
Efna4 T C 3: 89,242,555 (GRCm39) E113G probably damaging Het
Egr3 C A 14: 70,315,024 (GRCm39) A44D probably benign Het
Ercc3 T C 18: 32,381,363 (GRCm39) F393S probably damaging Het
Evi2 T A 11: 79,406,273 (GRCm39) probably benign Het
Fam78b T C 1: 166,906,216 (GRCm39) V125A probably benign Het
Fars2 A T 13: 36,721,400 (GRCm39) E448V probably damaging Het
Farsb A T 1: 78,401,833 (GRCm39) *590R probably null Het
Fat3 A G 9: 15,911,028 (GRCm39) M1658T probably benign Het
Fhod3 G T 18: 25,118,358 (GRCm39) V232F probably damaging Het
Fkbpl G A 17: 34,864,303 (GRCm39) A24T probably benign Het
Fzd3 A G 14: 65,472,607 (GRCm39) V387A possibly damaging Het
Gm1527 A G 3: 28,974,812 (GRCm39) I542V possibly damaging Het
Gm7964 A G 7: 83,405,109 (GRCm39) probably null Het
Hbs1l G T 10: 21,218,405 (GRCm39) G301C probably damaging Het
Hipk4 A G 7: 27,227,995 (GRCm39) H247R probably benign Het
Hmcn1 A G 1: 150,629,362 (GRCm39) V965A probably benign Het
Hoxa5 C T 6: 52,180,943 (GRCm39) A130T probably benign Het
Igf2r C T 17: 12,903,013 (GRCm39) V2346I possibly damaging Het
Igsf8 T C 1: 172,143,889 (GRCm39) V14A probably benign Het
Impg1 G A 9: 80,301,377 (GRCm39) P183L probably damaging Het
Isl1 T C 13: 116,441,966 (GRCm39) N89S probably benign Het
Itga1 C A 13: 115,171,921 (GRCm39) W61C probably damaging Het
Itga5 T C 15: 103,256,187 (GRCm39) R922G probably benign Het
Itgb5 T C 16: 33,705,391 (GRCm39) V227A possibly damaging Het
Jph4 G T 14: 55,347,165 (GRCm39) P461T probably damaging Het
Kcnab1 T A 3: 65,211,586 (GRCm39) probably null Het
Klrc1 T A 6: 129,654,725 (GRCm39) probably null Het
Lonrf2 A T 1: 38,855,119 (GRCm39) L92Q probably benign Het
Ly75 T C 2: 60,180,284 (GRCm39) E631G probably benign Het
Mapk13 T C 17: 28,994,528 (GRCm39) Y140H probably damaging Het
Meak7 A T 8: 120,495,093 (GRCm39) S222T probably benign Het
Mgat4d A G 8: 84,084,749 (GRCm39) E164G probably damaging Het
Mrtfa C T 15: 80,901,234 (GRCm39) S419N probably damaging Het
Mtcl2 A G 2: 156,862,172 (GRCm39) S1586P probably benign Het
Mthfs A T 9: 89,122,078 (GRCm39) H188L probably benign Het
Muc5b T A 7: 141,417,983 (GRCm39) M3643K possibly damaging Het
Mylk3 T C 8: 86,077,014 (GRCm39) Y474C probably damaging Het
Myo5b A G 18: 74,877,701 (GRCm39) T1567A possibly damaging Het
Ncaph2 T G 15: 89,255,010 (GRCm39) V478G probably damaging Het
Ncbp1 A G 4: 46,152,967 (GRCm39) R247G possibly damaging Het
Nedd9 T C 13: 41,471,376 (GRCm39) K208E probably benign Het
Nxph2 C T 2: 23,289,870 (GRCm39) T74M probably benign Het
Ogdh T A 11: 6,290,570 (GRCm39) M385K probably benign Het
Or10a5 A T 7: 106,636,121 (GRCm39) Y253F probably benign Het
Or3a1c A T 11: 74,046,417 (GRCm39) I146F probably benign Het
Or4a2 T C 2: 89,248,235 (GRCm39) H174R probably damaging Het
Or6a2 C T 7: 106,600,542 (GRCm39) G175D probably damaging Het
Or7g18 T C 9: 18,787,475 (GRCm39) V284A probably damaging Het
Or8b54 T A 9: 38,686,670 (GRCm39) F40I probably benign Het
Pcsk2 A C 2: 143,655,345 (GRCm39) I510L probably benign Het
Pdgfra A G 5: 75,349,972 (GRCm39) N952S probably benign Het
Pex26 T C 6: 121,170,516 (GRCm39) F287S probably damaging Het
Pick1 G C 15: 79,139,810 (GRCm39) probably benign Het
Plxnb1 G T 9: 108,943,663 (GRCm39) V1917L probably damaging Het
Polk T C 13: 96,625,764 (GRCm39) T347A probably benign Het
Ppp1r10 T G 17: 36,234,979 (GRCm39) I61R probably damaging Het
Prex1 A T 2: 166,434,211 (GRCm39) L503Q probably damaging Het
Ptp4a1 A C 1: 30,983,019 (GRCm39) I133R probably damaging Het
Rassf10 G T 7: 112,553,735 (GRCm39) R112L probably damaging Het
Ripor3 T A 2: 167,823,260 (GRCm39) I884F probably damaging Het
Rnft2 A G 5: 118,339,311 (GRCm39) Y369H probably damaging Het
Rtp3 A T 9: 110,815,522 (GRCm39) V281E probably benign Het
Runx1t1 T A 4: 13,837,767 (GRCm39) N51K probably damaging Het
Selp A G 1: 163,972,475 (GRCm39) T705A probably benign Het
Sgca A T 11: 94,861,553 (GRCm39) probably null Het
Slc22a3 T C 17: 12,642,675 (GRCm39) E514G probably damaging Het
Slc28a2b T A 2: 122,344,940 (GRCm39) I182N probably damaging Het
Slc2a1 G A 4: 118,989,642 (GRCm39) R61Q probably damaging Het
Smarcal1 G A 1: 72,636,599 (GRCm39) V425I probably benign Het
Ssx2ip T C 3: 146,124,114 (GRCm39) V43A probably benign Het
Synpo A G 18: 60,737,386 (GRCm39) S187P probably damaging Het
Thnsl1 T A 2: 21,216,856 (GRCm39) C203* probably null Het
Ttyh3 A T 5: 140,620,541 (GRCm39) I232N probably damaging Het
Upk1b T C 16: 38,607,604 (GRCm39) H41R probably benign Het
Zan A T 5: 137,379,112 (GRCm39) C5329* probably null Het
Zbtb40 C T 4: 136,725,953 (GRCm39) M535I probably benign Het
Zfp383 A C 7: 29,614,263 (GRCm39) T173P possibly damaging Het
Zfp7 T A 15: 76,775,546 (GRCm39) C529* probably null Het
Other mutations in Vmn2r76
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00969:Vmn2r76 APN 7 85,877,925 (GRCm39) missense probably benign
IGL01374:Vmn2r76 APN 7 85,874,857 (GRCm39) missense probably benign 0.02
IGL01419:Vmn2r76 APN 7 85,874,910 (GRCm39) missense probably benign 0.32
IGL01627:Vmn2r76 APN 7 85,874,871 (GRCm39) missense probably damaging 1.00
IGL01730:Vmn2r76 APN 7 85,879,406 (GRCm39) missense probably benign 0.02
IGL01957:Vmn2r76 APN 7 85,877,925 (GRCm39) missense probably benign
IGL02214:Vmn2r76 APN 7 85,879,138 (GRCm39) missense probably benign 0.07
IGL02489:Vmn2r76 APN 7 85,878,071 (GRCm39) missense probably benign 0.41
IGL02543:Vmn2r76 APN 7 85,879,356 (GRCm39) missense probably benign 0.06
IGL02579:Vmn2r76 APN 7 85,877,961 (GRCm39) nonsense probably null
IGL02598:Vmn2r76 APN 7 85,877,879 (GRCm39) missense probably benign 0.05
IGL02720:Vmn2r76 APN 7 85,874,914 (GRCm39) missense probably benign 0.35
IGL02745:Vmn2r76 APN 7 85,879,495 (GRCm39) missense probably benign 0.06
IGL03393:Vmn2r76 APN 7 85,879,034 (GRCm39) missense probably benign 0.01
R0483:Vmn2r76 UTSW 7 85,874,959 (GRCm39) missense probably damaging 1.00
R0513:Vmn2r76 UTSW 7 85,877,987 (GRCm39) missense probably benign 0.01
R0528:Vmn2r76 UTSW 7 85,879,506 (GRCm39) missense possibly damaging 0.80
R0601:Vmn2r76 UTSW 7 85,875,323 (GRCm39) critical splice acceptor site probably null
R0662:Vmn2r76 UTSW 7 85,879,578 (GRCm39) missense probably benign 0.39
R0883:Vmn2r76 UTSW 7 85,877,904 (GRCm39) missense probably benign 0.00
R1532:Vmn2r76 UTSW 7 85,879,454 (GRCm39) missense probably benign 0.02
R1694:Vmn2r76 UTSW 7 85,879,356 (GRCm39) missense probably benign 0.06
R1696:Vmn2r76 UTSW 7 85,880,464 (GRCm39) missense possibly damaging 0.56
R2135:Vmn2r76 UTSW 7 85,880,219 (GRCm39) missense probably benign 0.02
R2151:Vmn2r76 UTSW 7 85,879,692 (GRCm39) missense probably benign
R2181:Vmn2r76 UTSW 7 85,874,743 (GRCm39) missense probably benign 0.00
R2268:Vmn2r76 UTSW 7 85,879,707 (GRCm39) missense probably benign 0.03
R2877:Vmn2r76 UTSW 7 85,875,201 (GRCm39) missense probably benign 0.00
R3155:Vmn2r76 UTSW 7 85,874,959 (GRCm39) missense probably damaging 1.00
R3746:Vmn2r76 UTSW 7 85,874,763 (GRCm39) missense probably benign 0.11
R3799:Vmn2r76 UTSW 7 85,875,244 (GRCm39) missense probably benign 0.00
R3825:Vmn2r76 UTSW 7 85,880,415 (GRCm39) missense probably benign 0.10
R4058:Vmn2r76 UTSW 7 85,879,508 (GRCm39) missense probably benign 0.00
R4237:Vmn2r76 UTSW 7 85,879,740 (GRCm39) missense probably benign 0.00
R4404:Vmn2r76 UTSW 7 85,877,511 (GRCm39) missense probably benign 0.16
R4838:Vmn2r76 UTSW 7 85,874,733 (GRCm39) missense probably damaging 1.00
R5175:Vmn2r76 UTSW 7 85,877,915 (GRCm39) missense probably benign 0.00
R5268:Vmn2r76 UTSW 7 85,875,267 (GRCm39) missense probably damaging 1.00
R5381:Vmn2r76 UTSW 7 85,874,496 (GRCm39) missense probably damaging 1.00
R5531:Vmn2r76 UTSW 7 85,874,657 (GRCm39) missense probably damaging 1.00
R5566:Vmn2r76 UTSW 7 85,875,286 (GRCm39) missense probably damaging 1.00
R5646:Vmn2r76 UTSW 7 85,875,261 (GRCm39) missense probably damaging 0.98
R5664:Vmn2r76 UTSW 7 85,895,202 (GRCm39) critical splice donor site probably null
R5818:Vmn2r76 UTSW 7 85,879,142 (GRCm39) missense probably benign 0.00
R6093:Vmn2r76 UTSW 7 85,877,469 (GRCm39) nonsense probably null
R6651:Vmn2r76 UTSW 7 85,878,059 (GRCm39) missense possibly damaging 0.64
R6741:Vmn2r76 UTSW 7 85,879,560 (GRCm39) missense probably benign
R6750:Vmn2r76 UTSW 7 85,875,114 (GRCm39) missense probably damaging 1.00
R7082:Vmn2r76 UTSW 7 85,874,440 (GRCm39) missense probably benign 0.01
R7136:Vmn2r76 UTSW 7 85,877,975 (GRCm39) missense probably benign 0.06
R7524:Vmn2r76 UTSW 7 85,879,374 (GRCm39) missense probably benign 0.00
R7524:Vmn2r76 UTSW 7 85,874,577 (GRCm39) missense probably benign 0.22
R7611:Vmn2r76 UTSW 7 85,879,388 (GRCm39) missense probably benign 0.04
R7833:Vmn2r76 UTSW 7 85,877,892 (GRCm39) missense probably benign
R8002:Vmn2r76 UTSW 7 85,879,271 (GRCm39) missense probably benign 0.05
R8021:Vmn2r76 UTSW 7 85,874,958 (GRCm39) missense probably damaging 1.00
R8023:Vmn2r76 UTSW 7 85,879,028 (GRCm39) missense probably benign 0.00
R8250:Vmn2r76 UTSW 7 85,875,231 (GRCm39) missense possibly damaging 0.82
R8428:Vmn2r76 UTSW 7 85,874,479 (GRCm39) missense possibly damaging 0.63
R8874:Vmn2r76 UTSW 7 85,877,999 (GRCm39) missense probably damaging 1.00
R9139:Vmn2r76 UTSW 7 85,879,170 (GRCm39) missense probably benign 0.02
R9357:Vmn2r76 UTSW 7 85,880,428 (GRCm39) missense probably benign 0.43
Z1176:Vmn2r76 UTSW 7 85,895,271 (GRCm39) missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- GTAGTAACCCAGATTCTTCGAATGTC -3'
(R):5'- CTGGATCTTGTTAAATAGACCTACG -3'

Sequencing Primer
(F):5'- TTCGAATGTCTAAAAACTGCCACAG -3'
(R):5'- TTGTGTACTTTATCATCTTCAAGGTC -3'
Posted On 2016-02-04