Mutagenetix > Incidental Mutation

Incidental Mutation 'R4796:Plxnb1'

369063

Institutional Source

Beutler Lab

Gene Symbol

Plxnb1

Ensembl Gene

ENSMUSG00000053646

Gene Name

plexin B1

Synonyms

2900002G15Rik

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4796 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

109095389-109119917 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 109114595 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Leucine at position 1917 (V1917L)

Ref Sequence

ENSEMBL: ENSMUSP00000071966 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072093]

AlphaFold

Q8CJH3

Predicted Effect

probably damaging
Transcript: ENSMUST00000072093
AA Change: V1917L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000071966
Gene: ENSMUSG00000053646
AA Change: V1917L

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Sema	35	463	5.84e-101	SMART
PSI	481	534	1.17e-13	SMART
PSI	628	678	6.97e-3	SMART
low complexity region	691	706	N/A	INTRINSIC
low complexity region	752	771	N/A	INTRINSIC
PSI	1019	1066	2.06e-5	SMART
IPT	1067	1158	7.48e-18	SMART
IPT	1159	1247	3.97e-22	SMART
IPT	1249	1359	6.09e-9	SMART
low complexity region	1483	1494	N/A	INTRINSIC
Pfam:Plexin_cytopl	1546	2086	6.5e-230	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.8%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous null mutants are viable and fertile and show no apparent defects in development, adult histology or basic functional parameters. However, a transitory renal phenotype, characterized by increased ureteric branching and enlarged kidneys, is noted over early stages of renal development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 97 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9230104L09Rik	A	G	2: 148,850,738	F48S	probably damaging	Het
9930021J03Rik	G	A	19: 29,753,618	H665Y	probably benign	Het
Adgrv1	C	T	13: 81,155,231	W132*	probably null	Het
Atp8b3	A	G	10: 80,524,354	V961A	probably damaging	Het
Bglap	A	C	3: 88,384,405	I4S	unknown	Het
Bmp1	T	C	14: 70,492,073		probably null	Het
Btaf1	T	C	19: 36,956,428	L152P	possibly damaging	Het
Cacna1b	T	A	2: 24,637,487	T1621S	possibly damaging	Het
Capn3	A	T	2: 120,502,998	N621I	probably damaging	Het
Ccdc59	T	C	10: 105,841,568	S23P	probably benign	Het
Cd22	A	T	7: 30,872,956		probably null	Het
Cdh20	A	G	1: 104,941,264	D160G	probably damaging	Het
Cep112	T	C	11: 108,486,992		probably null	Het
Clock	T	C	5: 76,265,916	K44R	probably damaging	Het
Coq10b	A	G	1: 55,071,798	T242A	probably damaging	Het
Ctnnd1	G	T	2: 84,619,926	R317S	probably damaging	Het
Dlg5	G	A	14: 24,144,383	H1674Y	probably damaging	Het
Drc3	C	A	11: 60,363,528	N75K	probably damaging	Het
Efna4	T	C	3: 89,335,248	E113G	probably damaging	Het
Egr3	C	A	14: 70,077,575	A44D	probably benign	Het
Ercc3	T	C	18: 32,248,310	F393S	probably damaging	Het
Evi2	T	A	11: 79,515,447		probably benign	Het
Fam78b	T	C	1: 167,078,647	V125A	probably benign	Het
Fars2	A	T	13: 36,537,426	E448V	probably damaging	Het
Farsb	A	T	1: 78,425,196	*590R	probably null	Het
Fat3	A	G	9: 15,999,732	M1658T	probably benign	Het
Fhod3	G	T	18: 24,985,301	V232F	probably damaging	Het
Fkbpl	G	A	17: 34,645,329	A24T	probably benign	Het
Fzd3	A	G	14: 65,235,158	V387A	possibly damaging	Het
Gm14085	T	A	2: 122,514,459	I182N	probably damaging	Het
Gm1527	A	G	3: 28,920,663	I542V	possibly damaging	Het
Gm6583	A	G	5: 112,355,299	S180P	possibly damaging	Het
Gm7964	A	G	7: 83,755,901		probably null	Het
Hbs1l	G	T	10: 21,342,506	G301C	probably damaging	Het
Hipk4	A	G	7: 27,528,570	H247R	probably benign	Het
Hmcn1	A	G	1: 150,753,611	V965A	probably benign	Het
Hoxa5	C	T	6: 52,203,963	A130T	probably benign	Het
Igf2r	C	T	17: 12,684,126	V2346I	possibly damaging	Het
Igsf8	T	C	1: 172,316,322	V14A	probably benign	Het
Impg1	G	A	9: 80,394,095	P183L	probably damaging	Het
Isl1	T	C	13: 116,305,430	N89S	probably benign	Het
Itga1	C	A	13: 115,035,385	W61C	probably damaging	Het
Itga5	T	C	15: 103,347,760	R922G	probably benign	Het
Itgb5	T	C	16: 33,885,021	V227A	possibly damaging	Het
Jph4	G	T	14: 55,109,708	P461T	probably damaging	Het
Kcnab1	T	A	3: 65,304,165		probably null	Het
Klrc1	T	A	6: 129,677,762		probably null	Het
Lonrf2	A	T	1: 38,816,038	L92Q	probably benign	Het
Ly75	T	C	2: 60,349,940	E631G	probably benign	Het
Mapk13	T	C	17: 28,775,554	Y140H	probably damaging	Het
Mgat4d	A	G	8: 83,358,120	E164G	probably damaging	Het
Mkl1	C	T	15: 81,017,033	S419N	probably damaging	Het
Mthfs	A	T	9: 89,240,025	H188L	probably benign	Het
Muc5b	T	A	7: 141,864,246	M3643K	possibly damaging	Het
Mylk3	T	C	8: 85,350,385	Y474C	probably damaging	Het
Myo5b	A	G	18: 74,744,630	T1567A	possibly damaging	Het
Ncaph2	T	G	15: 89,370,807	V478G	probably damaging	Het
Ncbp1	A	G	4: 46,152,967	R247G	possibly damaging	Het
Nedd9	T	C	13: 41,317,900	K208E	probably benign	Het
Nxph2	C	T	2: 23,399,858	T74M	probably benign	Het
Ogdh	T	A	11: 6,340,570	M385K	probably benign	Het
Olfr1239	T	C	2: 89,417,891	H174R	probably damaging	Het
Olfr2	C	T	7: 107,001,335	G175D	probably damaging	Het
Olfr402	A	T	11: 74,155,591	I146F	probably benign	Het
Olfr713	A	T	7: 107,036,914	Y253F	probably benign	Het
Olfr830	T	C	9: 18,876,179	V284A	probably damaging	Het
Olfr921	T	A	9: 38,775,374	F40I	probably benign	Het
Pcsk2	A	C	2: 143,813,425	I510L	probably benign	Het
Pdgfra	A	G	5: 75,189,311	N952S	probably benign	Het
Pex26	T	C	6: 121,193,557	F287S	probably damaging	Het
Pick1	G	C	15: 79,255,610		probably benign	Het
Polk	T	C	13: 96,489,256	T347A	probably benign	Het
Ppp1r10	T	G	17: 35,924,087	I61R	probably damaging	Het
Prex1	A	T	2: 166,592,291	L503Q	probably damaging	Het
Ptp4a1	A	C	1: 30,943,938	I133R	probably damaging	Het
Rassf10	G	T	7: 112,954,528	R112L	probably damaging	Het
Ripor3	T	A	2: 167,981,340	I884F	probably damaging	Het
Rnft2	A	G	5: 118,201,246	Y369H	probably damaging	Het
Rtp3	A	T	9: 110,986,454	V281E	probably benign	Het
Runx1t1	T	A	4: 13,837,767	N51K	probably damaging	Het
Selp	A	G	1: 164,144,906	T705A	probably benign	Het
Sgca	A	T	11: 94,970,727		probably null	Het
Slc22a3	T	C	17: 12,423,788	E514G	probably damaging	Het
Slc2a1	G	A	4: 119,132,445	R61Q	probably damaging	Het
Smarcal1	G	A	1: 72,597,440	V425I	probably benign	Het
Soga1	A	G	2: 157,020,252	S1586P	probably benign	Het
Ssx2ip	T	C	3: 146,418,359	V43A	probably benign	Het
Synpo	A	G	18: 60,604,314	S187P	probably damaging	Het
Thnsl1	T	A	2: 21,212,045	C203*	probably null	Het
Tldc1	A	T	8: 119,768,354	S222T	probably benign	Het
Ttyh3	A	T	5: 140,634,786	I232N	probably damaging	Het
Upk1b	T	C	16: 38,787,242	H41R	probably benign	Het
Vmn2r76	T	C	7: 86,230,444	D216G	possibly damaging	Het
Zan	A	T	5: 137,380,850	C5329*	probably null	Het
Zbtb40	C	T	4: 136,998,642	M535I	probably benign	Het
Zfp383	A	C	7: 29,914,838	T173P	possibly damaging	Het
Zfp7	T	A	15: 76,891,346	C529*	probably null	Het

Other mutations in Plxnb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00593:Plxnb1	APN	9	109113868	missense	probably benign	0.04
IGL01014:Plxnb1	APN	9	109106034	missense	probably benign	0.00
IGL01142:Plxnb1	APN	9	109102697	missense	probably benign	0.05
IGL01454:Plxnb1	APN	9	109113354	missense	probably damaging	1.00
IGL01469:Plxnb1	APN	9	109105415	intron	probably benign
IGL01530:Plxnb1	APN	9	109110405	missense	probably benign	0.02
IGL01599:Plxnb1	APN	9	109110604	missense	probably damaging	1.00
IGL01968:Plxnb1	APN	9	109100984	missense	probably benign	0.00
IGL02175:Plxnb1	APN	9	109100846	missense	possibly damaging	0.85
IGL02216:Plxnb1	APN	9	109100850	missense	probably damaging	1.00
IGL02277:Plxnb1	APN	9	109112133	missense	probably damaging	1.00
IGL02311:Plxnb1	APN	9	109101122	missense	probably benign
IGL02645:Plxnb1	APN	9	109114243	splice site	probably benign
IGL03076:Plxnb1	APN	9	109106902	missense	probably damaging	0.96
IGL03107:Plxnb1	APN	9	109104986	missense	probably benign
IGL03343:Plxnb1	APN	9	109114712	missense	probably damaging	1.00
PIT4431001:Plxnb1	UTSW	9	109100718	missense	probably damaging	1.00
R0117:Plxnb1	UTSW	9	109105218	missense	possibly damaging	0.93
R0211:Plxnb1	UTSW	9	109103663	nonsense	probably null
R0211:Plxnb1	UTSW	9	109103663	nonsense	probably null
R0843:Plxnb1	UTSW	9	109113701	missense	probably benign	0.20
R0970:Plxnb1	UTSW	9	109103263	missense	probably damaging	1.00
R0973:Plxnb1	UTSW	9	109102142	missense	possibly damaging	0.47
R1342:Plxnb1	UTSW	9	109100652	missense	possibly damaging	0.87
R1386:Plxnb1	UTSW	9	109101023	missense	probably benign	0.27
R1419:Plxnb1	UTSW	9	109114386	missense	probably damaging	1.00
R1445:Plxnb1	UTSW	9	109108921	missense	probably null
R1548:Plxnb1	UTSW	9	109100900	missense	possibly damaging	0.95
R1621:Plxnb1	UTSW	9	109106805	missense	probably benign	0.04
R1658:Plxnb1	UTSW	9	109102871	nonsense	probably null
R1727:Plxnb1	UTSW	9	109101057	splice site	probably null
R1750:Plxnb1	UTSW	9	109111768	missense	probably benign	0.00
R1795:Plxnb1	UTSW	9	109100745	missense	probably benign
R1929:Plxnb1	UTSW	9	109102708	splice site	probably null
R1935:Plxnb1	UTSW	9	109095647	critical splice donor site	probably null
R1936:Plxnb1	UTSW	9	109095647	critical splice donor site	probably null
R2014:Plxnb1	UTSW	9	109106619	splice site	probably benign
R2057:Plxnb1	UTSW	9	109109226	missense	possibly damaging	0.71
R2102:Plxnb1	UTSW	9	109115742	missense	probably damaging	1.00
R2271:Plxnb1	UTSW	9	109102708	splice site	probably null
R2422:Plxnb1	UTSW	9	109108438	missense	probably benign	0.02
R2881:Plxnb1	UTSW	9	109114412	missense	probably damaging	1.00
R3409:Plxnb1	UTSW	9	109106613	splice site	probably null
R3417:Plxnb1	UTSW	9	109100760	missense	probably damaging	0.97
R3756:Plxnb1	UTSW	9	109113458	unclassified	probably benign
R3788:Plxnb1	UTSW	9	109109287	missense	possibly damaging	0.89
R3789:Plxnb1	UTSW	9	109109287	missense	possibly damaging	0.89
R4042:Plxnb1	UTSW	9	109105173	missense	probably benign	0.00
R4289:Plxnb1	UTSW	9	109114352	missense	probably damaging	1.00
R4396:Plxnb1	UTSW	9	109100223	missense	possibly damaging	0.51
R4564:Plxnb1	UTSW	9	109113420	missense	probably benign	0.10
R4676:Plxnb1	UTSW	9	109110435	missense	possibly damaging	0.63
R4706:Plxnb1	UTSW	9	109112028	missense	probably damaging	1.00
R4792:Plxnb1	UTSW	9	109110648	missense	probably damaging	1.00
R4835:Plxnb1	UTSW	9	109105374	missense	probably damaging	0.96
R4901:Plxnb1	UTSW	9	109104959	missense	probably benign	0.01
R4952:Plxnb1	UTSW	9	109114836	missense	probably damaging	1.00
R5005:Plxnb1	UTSW	9	109106579	missense	probably benign	0.00
R5015:Plxnb1	UTSW	9	109100430	missense	possibly damaging	0.95
R5029:Plxnb1	UTSW	9	109114655	missense	probably damaging	1.00
R5180:Plxnb1	UTSW	9	109111693	splice site	probably null
R5256:Plxnb1	UTSW	9	109114593	missense	probably damaging	1.00
R5285:Plxnb1	UTSW	9	109108459	missense	probably damaging	0.99
R5431:Plxnb1	UTSW	9	109100772	missense	probably damaging	1.00
R5444:Plxnb1	UTSW	9	109106453	missense	probably benign	0.22
R5546:Plxnb1	UTSW	9	109100750	missense	probably damaging	1.00
R5852:Plxnb1	UTSW	9	109106450	missense	probably damaging	1.00
R5892:Plxnb1	UTSW	9	109111707	missense	probably damaging	1.00
R6020:Plxnb1	UTSW	9	109116611	missense	probably damaging	1.00
R6053:Plxnb1	UTSW	9	109111707	missense	probably damaging	1.00
R6177:Plxnb1	UTSW	9	109102925	splice site	probably null
R6193:Plxnb1	UTSW	9	109104903	missense	probably benign
R6274:Plxnb1	UTSW	9	109112141	critical splice donor site	probably null
R6310:Plxnb1	UTSW	9	109109728	missense	probably damaging	0.96
R6404:Plxnb1	UTSW	9	109116637	missense	probably damaging	1.00
R6422:Plxnb1	UTSW	9	109108924	missense	probably damaging	1.00
R6479:Plxnb1	UTSW	9	109111665	missense	possibly damaging	0.92
R6555:Plxnb1	UTSW	9	109108405	critical splice acceptor site	probably null
R6646:Plxnb1	UTSW	9	109108827	missense	probably benign
R6648:Plxnb1	UTSW	9	109104330	missense	probably benign	0.14
R6661:Plxnb1	UTSW	9	109104299	missense	possibly damaging	0.94
R6674:Plxnb1	UTSW	9	109108146	missense	probably benign	0.00
R6734:Plxnb1	UTSW	9	109108920	nonsense	probably null
R6859:Plxnb1	UTSW	9	109106770	missense	probably damaging	1.00
R6948:Plxnb1	UTSW	9	109116634	missense	probably damaging	0.96
R7030:Plxnb1	UTSW	9	109112307	missense	probably damaging	1.00
R7038:Plxnb1	UTSW	9	109100385	missense	probably damaging	1.00
R7204:Plxnb1	UTSW	9	109100175	missense	probably damaging	1.00
R7427:Plxnb1	UTSW	9	109108168	missense	probably benign	0.01
R7428:Plxnb1	UTSW	9	109108168	missense	probably benign	0.01
R7443:Plxnb1	UTSW	9	109114607	missense	probably damaging	1.00
R7527:Plxnb1	UTSW	9	109100861	missense	probably damaging	0.99
R7645:Plxnb1	UTSW	9	109114412	missense	probably damaging	1.00
R7680:Plxnb1	UTSW	9	109100503	nonsense	probably null
R7866:Plxnb1	UTSW	9	109100457	missense	probably damaging	0.98
R7898:Plxnb1	UTSW	9	109114340	missense	probably damaging	1.00
R7905:Plxnb1	UTSW	9	109109232	missense	probably damaging	1.00
R8092:Plxnb1	UTSW	9	109100505	missense	probably damaging	1.00
R8150:Plxnb1	UTSW	9	109112078	missense	probably damaging	0.98
R8286:Plxnb1	UTSW	9	109106802	missense	probably damaging	1.00
R8290:Plxnb1	UTSW	9	109109619	missense	probably benign	0.00
R8987:Plxnb1	UTSW	9	109108110	splice site	probably benign
R9176:Plxnb1	UTSW	9	109112583	missense	probably damaging	1.00
R9231:Plxnb1	UTSW	9	109105218	missense	possibly damaging	0.59
R9698:Plxnb1	UTSW	9	109096183	start gained	probably benign
Z1177:Plxnb1	UTSW	9	109108921	missense	possibly damaging	0.70

Predicted Primers

PCR Primer
(F):5'- TCCCTGAGATCTACCTGACACG -3'
(R):5'- TAACTGTGCTGTGGAGGCAG -3'

Sequencing Primer
(F):5'- ACGCCTGCTATCCATGAAGGTG -3'
(R):5'- AGGCCCCCACATATGTCCTG -3'

Posted On

2016-02-04