Incidental Mutation 'R4796:Hbs1l'
ID369065
Institutional Source Beutler Lab
Gene Symbol Hbs1l
Ensembl Gene ENSMUSG00000019977
Gene NameHbs1-like (S. cerevisiae)
Synonyms2810035F15Rik, eRFS
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4796 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location21295979-21368898 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 21342506 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 301 (G301C)
Ref Sequence ENSEMBL: ENSMUSP00000151689 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020153] [ENSMUST00000218714] [ENSMUST00000219915]
Predicted Effect probably damaging
Transcript: ENSMUST00000020153
AA Change: G298C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020153
Gene: ENSMUSG00000019977
AA Change: G298C

DomainStartEndE-ValueType
Pfam:HBS1_N 33 125 1e-22 PFAM
low complexity region 142 155 N/A INTRINSIC
Pfam:GTP_EFTU 256 521 1.7e-48 PFAM
Pfam:GTP_EFTU_D3 572 681 9.2e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218108
Predicted Effect probably benign
Transcript: ENSMUST00000218714
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219345
Predicted Effect probably damaging
Transcript: ENSMUST00000219915
AA Change: G301C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GTP-binding elongation factor family. It is expressed in multiple tissues with the highest expression in heart and skeletal muscle. The intergenic region of this gene and the MYB gene has been identified to be a quantitative trait locus (QTL) controlling fetal hemoglobin level, and this region influnces erythrocyte, platelet, and monocyte counts as well as erythrocyte volume and hemoglobin content. DNA polymorphisms at this region associate with fetal hemoglobin levels and pain crises in sickle cell disease. A single nucleotide polymorphism in exon 1 of this gene is significantly associated with severity in beta-thalassemia/Hemoglobin E. Multiple alternatively spliced transcript variants encoding different protein isoforms have been found for this gene. [provided by RefSeq, May 2009]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230104L09Rik A G 2: 148,850,738 F48S probably damaging Het
9930021J03Rik G A 19: 29,753,618 H665Y probably benign Het
Adgrv1 C T 13: 81,155,231 W132* probably null Het
Atp8b3 A G 10: 80,524,354 V961A probably damaging Het
Bglap A C 3: 88,384,405 I4S unknown Het
Bmp1 T C 14: 70,492,073 probably null Het
Btaf1 T C 19: 36,956,428 L152P possibly damaging Het
Cacna1b T A 2: 24,637,487 T1621S possibly damaging Het
Capn3 A T 2: 120,502,998 N621I probably damaging Het
Ccdc59 T C 10: 105,841,568 S23P probably benign Het
Cd22 A T 7: 30,872,956 probably null Het
Cdh20 A G 1: 104,941,264 D160G probably damaging Het
Cep112 T C 11: 108,486,992 probably null Het
Clock T C 5: 76,265,916 K44R probably damaging Het
Coq10b A G 1: 55,071,798 T242A probably damaging Het
Ctnnd1 G T 2: 84,619,926 R317S probably damaging Het
Dlg5 G A 14: 24,144,383 H1674Y probably damaging Het
Drc3 C A 11: 60,363,528 N75K probably damaging Het
Efna4 T C 3: 89,335,248 E113G probably damaging Het
Egr3 C A 14: 70,077,575 A44D probably benign Het
Ercc3 T C 18: 32,248,310 F393S probably damaging Het
Evi2 T A 11: 79,515,447 probably benign Het
Fam78b T C 1: 167,078,647 V125A probably benign Het
Fars2 A T 13: 36,537,426 E448V probably damaging Het
Farsb A T 1: 78,425,196 *590R probably null Het
Fat3 A G 9: 15,999,732 M1658T probably benign Het
Fhod3 G T 18: 24,985,301 V232F probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Fzd3 A G 14: 65,235,158 V387A possibly damaging Het
Gm14085 T A 2: 122,514,459 I182N probably damaging Het
Gm1527 A G 3: 28,920,663 I542V possibly damaging Het
Gm6583 A G 5: 112,355,299 S180P possibly damaging Het
Gm7964 A G 7: 83,755,901 probably null Het
Hipk4 A G 7: 27,528,570 H247R probably benign Het
Hmcn1 A G 1: 150,753,611 V965A probably benign Het
Hoxa5 C T 6: 52,203,963 A130T probably benign Het
Igf2r C T 17: 12,684,126 V2346I possibly damaging Het
Igsf8 T C 1: 172,316,322 V14A probably benign Het
Impg1 G A 9: 80,394,095 P183L probably damaging Het
Isl1 T C 13: 116,305,430 N89S probably benign Het
Itga1 C A 13: 115,035,385 W61C probably damaging Het
Itga5 T C 15: 103,347,760 R922G probably benign Het
Itgb5 T C 16: 33,885,021 V227A possibly damaging Het
Jph4 G T 14: 55,109,708 P461T probably damaging Het
Kcnab1 T A 3: 65,304,165 probably null Het
Klrc1 T A 6: 129,677,762 probably null Het
Lonrf2 A T 1: 38,816,038 L92Q probably benign Het
Ly75 T C 2: 60,349,940 E631G probably benign Het
Mapk13 T C 17: 28,775,554 Y140H probably damaging Het
Mgat4d A G 8: 83,358,120 E164G probably damaging Het
Mkl1 C T 15: 81,017,033 S419N probably damaging Het
Mthfs A T 9: 89,240,025 H188L probably benign Het
Muc5b T A 7: 141,864,246 M3643K possibly damaging Het
Mylk3 T C 8: 85,350,385 Y474C probably damaging Het
Myo5b A G 18: 74,744,630 T1567A possibly damaging Het
Ncaph2 T G 15: 89,370,807 V478G probably damaging Het
Ncbp1 A G 4: 46,152,967 R247G possibly damaging Het
Nedd9 T C 13: 41,317,900 K208E probably benign Het
Nxph2 C T 2: 23,399,858 T74M probably benign Het
Ogdh T A 11: 6,340,570 M385K probably benign Het
Olfr1239 T C 2: 89,417,891 H174R probably damaging Het
Olfr2 C T 7: 107,001,335 G175D probably damaging Het
Olfr402 A T 11: 74,155,591 I146F probably benign Het
Olfr713 A T 7: 107,036,914 Y253F probably benign Het
Olfr830 T C 9: 18,876,179 V284A probably damaging Het
Olfr921 T A 9: 38,775,374 F40I probably benign Het
Pcsk2 A C 2: 143,813,425 I510L probably benign Het
Pdgfra A G 5: 75,189,311 N952S probably benign Het
Pex26 T C 6: 121,193,557 F287S probably damaging Het
Pick1 G C 15: 79,255,610 probably benign Het
Plxnb1 G T 9: 109,114,595 V1917L probably damaging Het
Polk T C 13: 96,489,256 T347A probably benign Het
Ppp1r10 T G 17: 35,924,087 I61R probably damaging Het
Prex1 A T 2: 166,592,291 L503Q probably damaging Het
Ptp4a1 A C 1: 30,943,938 I133R probably damaging Het
Rassf10 G T 7: 112,954,528 R112L probably damaging Het
Ripor3 T A 2: 167,981,340 I884F probably damaging Het
Rnft2 A G 5: 118,201,246 Y369H probably damaging Het
Rtp3 A T 9: 110,986,454 V281E probably benign Het
Runx1t1 T A 4: 13,837,767 N51K probably damaging Het
Selp A G 1: 164,144,906 T705A probably benign Het
Sgca A T 11: 94,970,727 probably null Het
Slc22a3 T C 17: 12,423,788 E514G probably damaging Het
Slc2a1 G A 4: 119,132,445 R61Q probably damaging Het
Smarcal1 G A 1: 72,597,440 V425I probably benign Het
Soga1 A G 2: 157,020,252 S1586P probably benign Het
Ssx2ip T C 3: 146,418,359 V43A probably benign Het
Synpo A G 18: 60,604,314 S187P probably damaging Het
Thnsl1 T A 2: 21,212,045 C203* probably null Het
Tldc1 A T 8: 119,768,354 S222T probably benign Het
Ttyh3 A T 5: 140,634,786 I232N probably damaging Het
Upk1b T C 16: 38,787,242 H41R probably benign Het
Vmn2r76 T C 7: 86,230,444 D216G possibly damaging Het
Zan A T 5: 137,380,850 C5329* probably null Het
Zbtb40 C T 4: 136,998,642 M535I probably benign Het
Zfp383 A C 7: 29,914,838 T173P possibly damaging Het
Zfp7 T A 15: 76,891,346 C529* probably null Het
Other mutations in Hbs1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01542:Hbs1l APN 10 21307756 missense probably benign 0.03
IGL02948:Hbs1l APN 10 21341711 splice site probably benign
R0375:Hbs1l UTSW 10 21342541 missense possibly damaging 0.76
R0465:Hbs1l UTSW 10 21352041 missense probably null 0.85
R0555:Hbs1l UTSW 10 21349323 missense probably benign 0.14
R0909:Hbs1l UTSW 10 21307738 missense probably benign 0.00
R1172:Hbs1l UTSW 10 21304638 missense probably damaging 1.00
R1594:Hbs1l UTSW 10 21352023 missense probably benign 0.00
R1612:Hbs1l UTSW 10 21358835 missense probably damaging 1.00
R1869:Hbs1l UTSW 10 21358406 splice site probably null
R2109:Hbs1l UTSW 10 21341932 nonsense probably null
R2369:Hbs1l UTSW 10 21307745 missense probably benign 0.01
R2404:Hbs1l UTSW 10 21296047 start gained probably benign
R4077:Hbs1l UTSW 10 21352602 missense probably damaging 1.00
R4079:Hbs1l UTSW 10 21352602 missense probably damaging 1.00
R4534:Hbs1l UTSW 10 21341915 missense possibly damaging 0.74
R4852:Hbs1l UTSW 10 21358388 missense possibly damaging 0.92
R5069:Hbs1l UTSW 10 21354647 missense probably damaging 1.00
R5946:Hbs1l UTSW 10 21341756 missense probably benign
R6232:Hbs1l UTSW 10 21307758 splice site probably null
R6264:Hbs1l UTSW 10 21367757 missense possibly damaging 0.92
R6542:Hbs1l UTSW 10 21304617 missense probably benign 0.11
R6831:Hbs1l UTSW 10 21341868 missense probably benign 0.29
R7295:Hbs1l UTSW 10 21310152 missense probably benign 0.12
R7470:Hbs1l UTSW 10 21358784 missense possibly damaging 0.96
R7652:Hbs1l UTSW 10 21364760 missense probably benign 0.02
R7695:Hbs1l UTSW 10 21299217 missense possibly damaging 0.49
R7909:Hbs1l UTSW 10 21358404 critical splice donor site probably null
R8325:Hbs1l UTSW 10 21307649 missense probably benign 0.02
R8353:Hbs1l UTSW 10 21309279 missense probably benign
R8453:Hbs1l UTSW 10 21309279 missense probably benign
R8878:Hbs1l UTSW 10 21358812 missense possibly damaging 0.47
R8880:Hbs1l UTSW 10 21309969 missense probably damaging 0.99
X0018:Hbs1l UTSW 10 21351987 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAATGCCTCAATGTGAGCATC -3'
(R):5'- TATGCCGAGGGAGCAACAAC -3'

Sequencing Primer
(F):5'- GCCTCAATGTGAGCATCTGAAATG -3'
(R):5'- ACTCAGGGAGCCTCACC -3'
Posted On2016-02-04