Incidental Mutation 'R4796:Ogdh'
ID369068
Institutional Source Beutler Lab
Gene Symbol Ogdh
Ensembl Gene ENSMUSG00000020456
Gene Nameoxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide)
Synonyms2210403E04Rik, alpha-ketoglutarate dehydrogenase, d1401, 2210412K19Rik
Accession Numbers

Genbank: NM_010956; MGI: 1098267; Ensembl: ENSMUST00000093350

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4796 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location6291633-6356642 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 6340570 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 385 (M385K)
Ref Sequence ENSEMBL: ENSMUSP00000099090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003461] [ENSMUST00000081894] [ENSMUST00000093350] [ENSMUST00000101554]
Predicted Effect probably benign
Transcript: ENSMUST00000003461
AA Change: M385K

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000003461
Gene: ENSMUSG00000020456
AA Change: M385K

DomainStartEndE-ValueType
Blast:Transket_pyr 131 199 8e-13 BLAST
Pfam:E1_dh 256 582 1.4e-95 PFAM
Transket_pyr 651 865 3.44e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000081894
AA Change: M381K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000080569
Gene: ENSMUSG00000020456
AA Change: M381K

DomainStartEndE-ValueType
Pfam:E1_dh 252 578 1e-96 PFAM
Transket_pyr 647 861 3.44e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000093350
AA Change: M396K

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000091041
Gene: ENSMUSG00000020456
AA Change: M396K

DomainStartEndE-ValueType
Pfam:2-oxogl_dehyd_N 47 87 6.6e-21 PFAM
Pfam:E1_dh 267 593 1.1e-101 PFAM
Transket_pyr 662 876 3.44e-50 SMART
Pfam:OxoGdeHyase_C 880 1025 8.7e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101554
AA Change: M385K

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000099090
Gene: ENSMUSG00000020456
AA Change: M385K

DomainStartEndE-ValueType
Blast:Transket_pyr 131 199 8e-13 BLAST
Pfam:E1_dh 256 582 1.4e-95 PFAM
Transket_pyr 651 865 3.44e-50 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one subunit of the 2-oxoglutarate dehydrogenase complex. This complex catalyzes the overall conversion of 2-oxoglutarate (alpha-ketoglutarate) to succinyl-CoA and CO(2) during the Krebs cycle. The protein is located in the mitochondrial matrix and uses thiamine pyrophosphate as a cofactor. A congenital deficiency in 2-oxoglutarate dehydrogenase activity is believed to lead to hypotonia, metabolic acidosis, and hyperlactatemia. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Sep 2009]
Allele List at MGI

All alleles(34) : Gene trapped(34)

Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230104L09Rik A G 2: 148,850,738 F48S probably damaging Het
9930021J03Rik G A 19: 29,753,618 H665Y probably benign Het
Adgrv1 C T 13: 81,155,231 W132* probably null Het
Atp8b3 A G 10: 80,524,354 V961A probably damaging Het
Bglap A C 3: 88,384,405 I4S unknown Het
Bmp1 T C 14: 70,492,073 probably null Het
Btaf1 T C 19: 36,956,428 L152P possibly damaging Het
Cacna1b T A 2: 24,637,487 T1621S possibly damaging Het
Capn3 A T 2: 120,502,998 N621I probably damaging Het
Ccdc59 T C 10: 105,841,568 S23P probably benign Het
Cd22 A T 7: 30,872,956 probably null Het
Cdh20 A G 1: 104,941,264 D160G probably damaging Het
Cep112 T C 11: 108,486,992 probably null Het
Clock T C 5: 76,265,916 K44R probably damaging Het
Coq10b A G 1: 55,071,798 T242A probably damaging Het
Ctnnd1 G T 2: 84,619,926 R317S probably damaging Het
Dlg5 G A 14: 24,144,383 H1674Y probably damaging Het
Drc3 C A 11: 60,363,528 N75K probably damaging Het
Efna4 T C 3: 89,335,248 E113G probably damaging Het
Egr3 C A 14: 70,077,575 A44D probably benign Het
Ercc3 T C 18: 32,248,310 F393S probably damaging Het
Evi2 T A 11: 79,515,447 probably benign Het
Fam78b T C 1: 167,078,647 V125A probably benign Het
Fars2 A T 13: 36,537,426 E448V probably damaging Het
Farsb A T 1: 78,425,196 *590R probably null Het
Fat3 A G 9: 15,999,732 M1658T probably benign Het
Fhod3 G T 18: 24,985,301 V232F probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Fzd3 A G 14: 65,235,158 V387A possibly damaging Het
Gm14085 T A 2: 122,514,459 I182N probably damaging Het
Gm1527 A G 3: 28,920,663 I542V possibly damaging Het
Gm6583 A G 5: 112,355,299 S180P possibly damaging Het
Gm7964 A G 7: 83,755,901 probably null Het
Hbs1l G T 10: 21,342,506 G301C probably damaging Het
Hipk4 A G 7: 27,528,570 H247R probably benign Het
Hmcn1 A G 1: 150,753,611 V965A probably benign Het
Hoxa5 C T 6: 52,203,963 A130T probably benign Het
Igf2r C T 17: 12,684,126 V2346I possibly damaging Het
Igsf8 T C 1: 172,316,322 V14A probably benign Het
Impg1 G A 9: 80,394,095 P183L probably damaging Het
Isl1 T C 13: 116,305,430 N89S probably benign Het
Itga1 C A 13: 115,035,385 W61C probably damaging Het
Itga5 T C 15: 103,347,760 R922G probably benign Het
Itgb5 T C 16: 33,885,021 V227A possibly damaging Het
Jph4 G T 14: 55,109,708 P461T probably damaging Het
Kcnab1 T A 3: 65,304,165 probably null Het
Klrc1 T A 6: 129,677,762 probably null Het
Lonrf2 A T 1: 38,816,038 L92Q probably benign Het
Ly75 T C 2: 60,349,940 E631G probably benign Het
Mapk13 T C 17: 28,775,554 Y140H probably damaging Het
Mgat4d A G 8: 83,358,120 E164G probably damaging Het
Mkl1 C T 15: 81,017,033 S419N probably damaging Het
Mthfs A T 9: 89,240,025 H188L probably benign Het
Muc5b T A 7: 141,864,246 M3643K possibly damaging Het
Mylk3 T C 8: 85,350,385 Y474C probably damaging Het
Myo5b A G 18: 74,744,630 T1567A possibly damaging Het
Ncaph2 T G 15: 89,370,807 V478G probably damaging Het
Ncbp1 A G 4: 46,152,967 R247G possibly damaging Het
Nedd9 T C 13: 41,317,900 K208E probably benign Het
Nxph2 C T 2: 23,399,858 T74M probably benign Het
Olfr1239 T C 2: 89,417,891 H174R probably damaging Het
Olfr2 C T 7: 107,001,335 G175D probably damaging Het
Olfr402 A T 11: 74,155,591 I146F probably benign Het
Olfr713 A T 7: 107,036,914 Y253F probably benign Het
Olfr830 T C 9: 18,876,179 V284A probably damaging Het
Olfr921 T A 9: 38,775,374 F40I probably benign Het
Pcsk2 A C 2: 143,813,425 I510L probably benign Het
Pdgfra A G 5: 75,189,311 N952S probably benign Het
Pex26 T C 6: 121,193,557 F287S probably damaging Het
Pick1 G C 15: 79,255,610 probably benign Het
Plxnb1 G T 9: 109,114,595 V1917L probably damaging Het
Polk T C 13: 96,489,256 T347A probably benign Het
Ppp1r10 T G 17: 35,924,087 I61R probably damaging Het
Prex1 A T 2: 166,592,291 L503Q probably damaging Het
Ptp4a1 A C 1: 30,943,938 I133R probably damaging Het
Rassf10 G T 7: 112,954,528 R112L probably damaging Het
Ripor3 T A 2: 167,981,340 I884F probably damaging Het
Rnft2 A G 5: 118,201,246 Y369H probably damaging Het
Rtp3 A T 9: 110,986,454 V281E probably benign Het
Runx1t1 T A 4: 13,837,767 N51K probably damaging Het
Selp A G 1: 164,144,906 T705A probably benign Het
Sgca A T 11: 94,970,727 probably null Het
Slc22a3 T C 17: 12,423,788 E514G probably damaging Het
Slc2a1 G A 4: 119,132,445 R61Q probably damaging Het
Smarcal1 G A 1: 72,597,440 V425I probably benign Het
Soga1 A G 2: 157,020,252 S1586P probably benign Het
Ssx2ip T C 3: 146,418,359 V43A probably benign Het
Synpo A G 18: 60,604,314 S187P probably damaging Het
Thnsl1 T A 2: 21,212,045 C203* probably null Het
Tldc1 A T 8: 119,768,354 S222T probably benign Het
Ttyh3 A T 5: 140,634,786 I232N probably damaging Het
Upk1b T C 16: 38,787,242 H41R probably benign Het
Vmn2r76 T C 7: 86,230,444 D216G possibly damaging Het
Zan A T 5: 137,380,850 C5329* probably null Het
Zbtb40 C T 4: 136,998,642 M535I probably benign Het
Zfp383 A C 7: 29,914,838 T173P possibly damaging Het
Zfp7 T A 15: 76,891,346 C529* probably null Het
Other mutations in Ogdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01109:Ogdh APN 11 6348790 missense probably damaging 1.00
IGL01503:Ogdh APN 11 6355069 missense probably damaging 1.00
IGL01684:Ogdh APN 11 6342546 missense probably damaging 1.00
IGL02141:Ogdh APN 11 6355015 missense probably damaging 1.00
IGL02313:Ogdh APN 11 6355400 missense probably damaging 0.98
IGL02818:Ogdh APN 11 6348270 missense probably benign
N/A - 535:Ogdh UTSW 11 6324911 missense possibly damaging 0.60
PIT4498001:Ogdh UTSW 11 6340504 missense probably benign 0.09
R0328:Ogdh UTSW 11 6347216 missense probably benign 0.01
R0505:Ogdh UTSW 11 6339936 splice site probably benign
R0627:Ogdh UTSW 11 6347216 missense possibly damaging 0.78
R1119:Ogdh UTSW 11 6340544 missense probably damaging 1.00
R1480:Ogdh UTSW 11 6347827 critical splice acceptor site probably null
R1591:Ogdh UTSW 11 6349384 missense probably damaging 1.00
R1804:Ogdh UTSW 11 6338565 missense probably damaging 1.00
R1873:Ogdh UTSW 11 6340438 splice site probably benign
R1959:Ogdh UTSW 11 6346638 missense possibly damaging 0.49
R2004:Ogdh UTSW 11 6334626 missense possibly damaging 0.90
R2080:Ogdh UTSW 11 6349393 missense probably benign 0.00
R2384:Ogdh UTSW 11 6342526 missense probably damaging 1.00
R2656:Ogdh UTSW 11 6348678 missense probably benign
R2883:Ogdh UTSW 11 6334545 missense probably damaging 1.00
R3405:Ogdh UTSW 11 6349462 missense probably damaging 1.00
R3838:Ogdh UTSW 11 6338627 nonsense probably null
R3933:Ogdh UTSW 11 6342601 missense possibly damaging 0.72
R3939:Ogdh UTSW 11 6350655 nonsense probably null
R4296:Ogdh UTSW 11 6349374 missense probably damaging 0.97
R4393:Ogdh UTSW 11 6316772 missense probably damaging 1.00
R4427:Ogdh UTSW 11 6355421 missense probably benign 0.01
R4667:Ogdh UTSW 11 6340600 missense probably benign 0.20
R4669:Ogdh UTSW 11 6340600 missense probably benign 0.20
R4728:Ogdh UTSW 11 6342549 missense probably damaging 1.00
R4737:Ogdh UTSW 11 6297044 missense probably benign
R4785:Ogdh UTSW 11 6349875 missense probably damaging 1.00
R5333:Ogdh UTSW 11 6352126 missense probably damaging 1.00
R5592:Ogdh UTSW 11 6316763 splice site probably null
R6318:Ogdh UTSW 11 6349390 missense probably damaging 0.99
R6875:Ogdh UTSW 11 6340477 missense probably benign 0.12
R6988:Ogdh UTSW 11 6313806 nonsense probably null
R7406:Ogdh UTSW 11 6348351 missense probably benign 0.00
R7724:Ogdh UTSW 11 6324887 missense probably benign
R7763:Ogdh UTSW 11 6338558 missense probably benign
R7909:Ogdh UTSW 11 6313965 missense possibly damaging 0.55
R8207:Ogdh UTSW 11 6349329 missense probably benign 0.38
R8348:Ogdh UTSW 11 6342619 missense probably damaging 0.98
R8401:Ogdh UTSW 11 6297174 nonsense probably null
R8448:Ogdh UTSW 11 6342619 missense probably damaging 0.98
R8770:Ogdh UTSW 11 6355336 missense probably damaging 1.00
R8796:Ogdh UTSW 11 6347129 missense possibly damaging 0.75
Z1088:Ogdh UTSW 11 6355427 missense probably benign
Z1177:Ogdh UTSW 11 6297051 missense probably benign
Z1177:Ogdh UTSW 11 6316982 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- TGCCATTGAGAGTGAACCTC -3'
(R):5'- GTGACAAGTCTCTCCTGCTG -3'

Sequencing Primer
(F):5'- GAACTAACTCTTTAGACCAGGCTGG -3'
(R):5'- GCTGTCTGCATCCCACAC -3'
Posted On2016-02-04