Incidental Mutation 'R4796:Polk'
ID 369078
Institutional Source Beutler Lab
Gene Symbol Polk
Ensembl Gene ENSMUSG00000021668
Gene Name polymerase (DNA directed), kappa
Synonyms Dinb1
Accession Numbers
Essential gene? Probably non essential (E-score: 0.159) question?
Stock # R4796 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 96617198-96679087 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 96625764 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 347 (T347A)
Ref Sequence ENSEMBL: ENSMUSP00000152192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022172] [ENSMUST00000091387] [ENSMUST00000165358] [ENSMUST00000220977] [ENSMUST00000221645] [ENSMUST00000221899] [ENSMUST00000222075] [ENSMUST00000222389] [ENSMUST00000222143]
AlphaFold Q9QUG2
Predicted Effect probably benign
Transcript: ENSMUST00000022172
AA Change: T427A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000022172
Gene: ENSMUSG00000021668
AA Change: T427A

DomainStartEndE-ValueType
Pfam:IMS 105 324 1.7e-47 PFAM
Pfam:IMS_C 406 525 5.5e-22 PFAM
PDB:2LSJ|B 559 582 9e-8 PDB
ZnF_Rad18 619 645 2.89e-9 SMART
ZnF_Rad18 761 787 2.31e-8 SMART
low complexity region 828 839 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000091387
AA Change: T368A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000088950
Gene: ENSMUSG00000021668
AA Change: T368A

DomainStartEndE-ValueType
Pfam:IMS 105 265 1.1e-37 PFAM
Pfam:IMS_C 346 469 8.8e-19 PFAM
PDB:2LSJ|B 500 523 9e-8 PDB
ZnF_Rad18 560 586 2.89e-9 SMART
ZnF_Rad18 702 728 2.31e-8 SMART
low complexity region 769 780 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165358
Predicted Effect probably benign
Transcript: ENSMUST00000220977
AA Change: T347A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000221645
AA Change: T427A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000221899
AA Change: T347A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000222075
Predicted Effect probably benign
Transcript: ENSMUST00000222389
AA Change: T347A

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222268
Predicted Effect probably benign
Transcript: ENSMUST00000222143
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DNA polymerase type-Y family of proteins. The encoded protein is a specialized DNA polymerase that catalyzes translesion DNA synthesis, which allows DNA replication in the presence of DNA lesions. Human cell lines lacking a functional copy of this gene exhibit impaired genome integrity and enhanced susceptibility to oxidative damage. Mutations in this gene that impair enzyme activity may be associated with prostate cancer in human patients. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygous mutation of this gene that results in a truncated transcript results in a higher rate of spontaneous germline expanded simple tandem repeat mutations. Homozyogus null mice exhibit normal immunoglobulin gene somatic hypermutation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 C T 13: 81,303,350 (GRCm39) W132* probably null Het
Atp8b3 A G 10: 80,360,188 (GRCm39) V961A probably damaging Het
Bglap A C 3: 88,291,712 (GRCm39) I4S unknown Het
Bmp1 T C 14: 70,729,513 (GRCm39) probably null Het
Brd10 G A 19: 29,731,018 (GRCm39) H665Y probably benign Het
Btaf1 T C 19: 36,933,828 (GRCm39) L152P possibly damaging Het
Cacna1b T A 2: 24,527,499 (GRCm39) T1621S possibly damaging Het
Capn3 A T 2: 120,333,479 (GRCm39) N621I probably damaging Het
Ccdc121rt3 A G 5: 112,503,165 (GRCm39) S180P possibly damaging Het
Ccdc59 T C 10: 105,677,429 (GRCm39) S23P probably benign Het
Cd22 A T 7: 30,572,381 (GRCm39) probably null Het
Cdh20 A G 1: 104,868,989 (GRCm39) D160G probably damaging Het
Cep112 T C 11: 108,377,818 (GRCm39) probably null Het
Clock T C 5: 76,413,763 (GRCm39) K44R probably damaging Het
Coq10b A G 1: 55,110,957 (GRCm39) T242A probably damaging Het
Cstdc2 A G 2: 148,692,658 (GRCm39) F48S probably damaging Het
Ctnnd1 G T 2: 84,450,270 (GRCm39) R317S probably damaging Het
Dlg5 G A 14: 24,194,451 (GRCm39) H1674Y probably damaging Het
Drc3 C A 11: 60,254,354 (GRCm39) N75K probably damaging Het
Efna4 T C 3: 89,242,555 (GRCm39) E113G probably damaging Het
Egr3 C A 14: 70,315,024 (GRCm39) A44D probably benign Het
Ercc3 T C 18: 32,381,363 (GRCm39) F393S probably damaging Het
Evi2 T A 11: 79,406,273 (GRCm39) probably benign Het
Fam78b T C 1: 166,906,216 (GRCm39) V125A probably benign Het
Fars2 A T 13: 36,721,400 (GRCm39) E448V probably damaging Het
Farsb A T 1: 78,401,833 (GRCm39) *590R probably null Het
Fat3 A G 9: 15,911,028 (GRCm39) M1658T probably benign Het
Fhod3 G T 18: 25,118,358 (GRCm39) V232F probably damaging Het
Fkbpl G A 17: 34,864,303 (GRCm39) A24T probably benign Het
Fzd3 A G 14: 65,472,607 (GRCm39) V387A possibly damaging Het
Gm1527 A G 3: 28,974,812 (GRCm39) I542V possibly damaging Het
Gm7964 A G 7: 83,405,109 (GRCm39) probably null Het
Hbs1l G T 10: 21,218,405 (GRCm39) G301C probably damaging Het
Hipk4 A G 7: 27,227,995 (GRCm39) H247R probably benign Het
Hmcn1 A G 1: 150,629,362 (GRCm39) V965A probably benign Het
Hoxa5 C T 6: 52,180,943 (GRCm39) A130T probably benign Het
Igf2r C T 17: 12,903,013 (GRCm39) V2346I possibly damaging Het
Igsf8 T C 1: 172,143,889 (GRCm39) V14A probably benign Het
Impg1 G A 9: 80,301,377 (GRCm39) P183L probably damaging Het
Isl1 T C 13: 116,441,966 (GRCm39) N89S probably benign Het
Itga1 C A 13: 115,171,921 (GRCm39) W61C probably damaging Het
Itga5 T C 15: 103,256,187 (GRCm39) R922G probably benign Het
Itgb5 T C 16: 33,705,391 (GRCm39) V227A possibly damaging Het
Jph4 G T 14: 55,347,165 (GRCm39) P461T probably damaging Het
Kcnab1 T A 3: 65,211,586 (GRCm39) probably null Het
Klrc1 T A 6: 129,654,725 (GRCm39) probably null Het
Lonrf2 A T 1: 38,855,119 (GRCm39) L92Q probably benign Het
Ly75 T C 2: 60,180,284 (GRCm39) E631G probably benign Het
Mapk13 T C 17: 28,994,528 (GRCm39) Y140H probably damaging Het
Meak7 A T 8: 120,495,093 (GRCm39) S222T probably benign Het
Mgat4d A G 8: 84,084,749 (GRCm39) E164G probably damaging Het
Mrtfa C T 15: 80,901,234 (GRCm39) S419N probably damaging Het
Mtcl2 A G 2: 156,862,172 (GRCm39) S1586P probably benign Het
Mthfs A T 9: 89,122,078 (GRCm39) H188L probably benign Het
Muc5b T A 7: 141,417,983 (GRCm39) M3643K possibly damaging Het
Mylk3 T C 8: 86,077,014 (GRCm39) Y474C probably damaging Het
Myo5b A G 18: 74,877,701 (GRCm39) T1567A possibly damaging Het
Ncaph2 T G 15: 89,255,010 (GRCm39) V478G probably damaging Het
Ncbp1 A G 4: 46,152,967 (GRCm39) R247G possibly damaging Het
Nedd9 T C 13: 41,471,376 (GRCm39) K208E probably benign Het
Nxph2 C T 2: 23,289,870 (GRCm39) T74M probably benign Het
Ogdh T A 11: 6,290,570 (GRCm39) M385K probably benign Het
Or10a5 A T 7: 106,636,121 (GRCm39) Y253F probably benign Het
Or3a1c A T 11: 74,046,417 (GRCm39) I146F probably benign Het
Or4a2 T C 2: 89,248,235 (GRCm39) H174R probably damaging Het
Or6a2 C T 7: 106,600,542 (GRCm39) G175D probably damaging Het
Or7g18 T C 9: 18,787,475 (GRCm39) V284A probably damaging Het
Or8b54 T A 9: 38,686,670 (GRCm39) F40I probably benign Het
Pcsk2 A C 2: 143,655,345 (GRCm39) I510L probably benign Het
Pdgfra A G 5: 75,349,972 (GRCm39) N952S probably benign Het
Pex26 T C 6: 121,170,516 (GRCm39) F287S probably damaging Het
Pick1 G C 15: 79,139,810 (GRCm39) probably benign Het
Plxnb1 G T 9: 108,943,663 (GRCm39) V1917L probably damaging Het
Ppp1r10 T G 17: 36,234,979 (GRCm39) I61R probably damaging Het
Prex1 A T 2: 166,434,211 (GRCm39) L503Q probably damaging Het
Ptp4a1 A C 1: 30,983,019 (GRCm39) I133R probably damaging Het
Rassf10 G T 7: 112,553,735 (GRCm39) R112L probably damaging Het
Ripor3 T A 2: 167,823,260 (GRCm39) I884F probably damaging Het
Rnft2 A G 5: 118,339,311 (GRCm39) Y369H probably damaging Het
Rtp3 A T 9: 110,815,522 (GRCm39) V281E probably benign Het
Runx1t1 T A 4: 13,837,767 (GRCm39) N51K probably damaging Het
Selp A G 1: 163,972,475 (GRCm39) T705A probably benign Het
Sgca A T 11: 94,861,553 (GRCm39) probably null Het
Slc22a3 T C 17: 12,642,675 (GRCm39) E514G probably damaging Het
Slc28a2b T A 2: 122,344,940 (GRCm39) I182N probably damaging Het
Slc2a1 G A 4: 118,989,642 (GRCm39) R61Q probably damaging Het
Smarcal1 G A 1: 72,636,599 (GRCm39) V425I probably benign Het
Ssx2ip T C 3: 146,124,114 (GRCm39) V43A probably benign Het
Synpo A G 18: 60,737,386 (GRCm39) S187P probably damaging Het
Thnsl1 T A 2: 21,216,856 (GRCm39) C203* probably null Het
Ttyh3 A T 5: 140,620,541 (GRCm39) I232N probably damaging Het
Upk1b T C 16: 38,607,604 (GRCm39) H41R probably benign Het
Vmn2r76 T C 7: 85,879,652 (GRCm39) D216G possibly damaging Het
Zan A T 5: 137,379,112 (GRCm39) C5329* probably null Het
Zbtb40 C T 4: 136,725,953 (GRCm39) M535I probably benign Het
Zfp383 A C 7: 29,614,263 (GRCm39) T173P possibly damaging Het
Zfp7 T A 15: 76,775,546 (GRCm39) C529* probably null Het
Other mutations in Polk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00491:Polk APN 13 96,633,268 (GRCm39) missense probably benign 0.25
IGL01803:Polk APN 13 96,641,030 (GRCm39) missense probably damaging 1.00
IGL01949:Polk APN 13 96,620,046 (GRCm39) missense probably benign 0.10
IGL01986:Polk APN 13 96,620,331 (GRCm39) missense probably benign 0.09
IGL02073:Polk APN 13 96,641,059 (GRCm39) missense probably damaging 1.00
IGL03165:Polk APN 13 96,653,196 (GRCm39) missense probably benign 0.23
IGL03184:Polk APN 13 96,620,491 (GRCm39) missense probably benign 0.04
IGL03353:Polk APN 13 96,625,719 (GRCm39) missense probably damaging 1.00
R0019:Polk UTSW 13 96,641,124 (GRCm39) missense probably damaging 1.00
R0029:Polk UTSW 13 96,653,178 (GRCm39) missense probably damaging 1.00
R0200:Polk UTSW 13 96,633,330 (GRCm39) missense probably benign 0.11
R0357:Polk UTSW 13 96,641,105 (GRCm39) missense probably damaging 0.99
R0485:Polk UTSW 13 96,620,272 (GRCm39) missense probably benign 0.05
R0555:Polk UTSW 13 96,620,687 (GRCm39) missense probably damaging 0.97
R0687:Polk UTSW 13 96,620,525 (GRCm39) missense probably damaging 1.00
R0980:Polk UTSW 13 96,620,272 (GRCm39) missense probably benign 0.05
R1065:Polk UTSW 13 96,644,760 (GRCm39) missense probably damaging 1.00
R1396:Polk UTSW 13 96,620,716 (GRCm39) missense probably benign 0.02
R1710:Polk UTSW 13 96,625,712 (GRCm39) missense probably damaging 1.00
R1770:Polk UTSW 13 96,631,950 (GRCm39) missense probably damaging 1.00
R1789:Polk UTSW 13 96,633,140 (GRCm39) missense probably damaging 1.00
R1977:Polk UTSW 13 96,625,736 (GRCm39) missense probably damaging 1.00
R2301:Polk UTSW 13 96,620,652 (GRCm39) missense probably benign 0.09
R3797:Polk UTSW 13 96,623,490 (GRCm39) splice site probably benign
R3934:Polk UTSW 13 96,638,143 (GRCm39) missense possibly damaging 0.56
R4082:Polk UTSW 13 96,620,181 (GRCm39) missense probably benign 0.17
R4307:Polk UTSW 13 96,633,174 (GRCm39) missense possibly damaging 0.79
R4472:Polk UTSW 13 96,630,413 (GRCm39) missense probably damaging 1.00
R4779:Polk UTSW 13 96,632,999 (GRCm39) critical splice donor site probably null
R4795:Polk UTSW 13 96,625,764 (GRCm39) missense probably benign 0.01
R4810:Polk UTSW 13 96,620,003 (GRCm39) missense possibly damaging 0.90
R5002:Polk UTSW 13 96,625,752 (GRCm39) missense probably damaging 1.00
R5271:Polk UTSW 13 96,620,047 (GRCm39) missense probably benign 0.09
R5415:Polk UTSW 13 96,620,463 (GRCm39) missense probably benign
R5459:Polk UTSW 13 96,631,984 (GRCm39) missense probably damaging 1.00
R5535:Polk UTSW 13 96,632,005 (GRCm39) missense probably damaging 1.00
R5619:Polk UTSW 13 96,620,064 (GRCm39) missense probably damaging 1.00
R5757:Polk UTSW 13 96,620,760 (GRCm39) missense probably benign 0.03
R5801:Polk UTSW 13 96,620,094 (GRCm39) missense probably damaging 1.00
R5923:Polk UTSW 13 96,631,923 (GRCm39) missense probably damaging 1.00
R6365:Polk UTSW 13 96,620,517 (GRCm39) missense probably damaging 1.00
R6670:Polk UTSW 13 96,633,138 (GRCm39) nonsense probably null
R6831:Polk UTSW 13 96,631,999 (GRCm39) missense possibly damaging 0.87
R6932:Polk UTSW 13 96,653,189 (GRCm39) missense probably damaging 1.00
R7216:Polk UTSW 13 96,644,728 (GRCm39) missense probably benign 0.32
R7654:Polk UTSW 13 96,633,321 (GRCm39) missense probably benign 0.02
R8122:Polk UTSW 13 96,620,291 (GRCm39) missense probably benign 0.01
R8222:Polk UTSW 13 96,632,023 (GRCm39) missense possibly damaging 0.95
R9024:Polk UTSW 13 96,623,340 (GRCm39) missense probably benign 0.00
R9500:Polk UTSW 13 96,630,349 (GRCm39) missense probably damaging 0.99
R9789:Polk UTSW 13 96,630,403 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACGTCAGACTCTCTGTTTC -3'
(R):5'- TGCTGATCAGTGTGCCTATGC -3'

Sequencing Primer
(F):5'- GACGTCAGACTCTCTGTTTCTGATTG -3'
(R):5'- GCCTATGCAAATGGCTTTTGATC -3'
Posted On 2016-02-04