Incidental Mutation 'R4796:Mrtfa'
ID 369089
Institutional Source Beutler Lab
Gene Symbol Mrtfa
Ensembl Gene ENSMUSG00000042292
Gene Name myocardin related transcription factor A
Synonyms Mal, Bsac, Mkl1, MRTF-A
Accession Numbers
Essential gene? Possibly essential (E-score: 0.663) question?
Stock # R4796 (G1)
Quality Score 192
Status Not validated
Chromosome 15
Chromosomal Location 80896482-81074937 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 80901234 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Asparagine at position 419 (S419N)
Ref Sequence ENSEMBL: ENSMUSP00000118451 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109579] [ENSMUST00000131235] [ENSMUST00000134469] [ENSMUST00000135047] [ENSMUST00000149582] [ENSMUST00000139517]
AlphaFold Q8K4J6
Predicted Effect probably benign
Transcript: ENSMUST00000109579
AA Change: S454N

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000105207
Gene: ENSMUSG00000042292
AA Change: S454N

DomainStartEndE-ValueType
RPEL 15 40 2.17e-7 SMART
RPEL 59 84 1.36e-8 SMART
RPEL 103 128 1.03e-8 SMART
low complexity region 146 159 N/A INTRINSIC
low complexity region 209 228 N/A INTRINSIC
low complexity region 259 272 N/A INTRINSIC
low complexity region 298 320 N/A INTRINSIC
low complexity region 340 365 N/A INTRINSIC
SAP 385 419 4.98e-10 SMART
low complexity region 424 433 N/A INTRINSIC
low complexity region 483 496 N/A INTRINSIC
coiled coil region 558 600 N/A INTRINSIC
low complexity region 670 679 N/A INTRINSIC
low complexity region 714 735 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124845
Predicted Effect probably benign
Transcript: ENSMUST00000131235
AA Change: S369N

PolyPhen 2 Score 0.247 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000120116
Gene: ENSMUSG00000042292
AA Change: S369N

DomainStartEndE-ValueType
RPEL 24 49 1.36e-8 SMART
RPEL 68 93 1.03e-8 SMART
low complexity region 111 124 N/A INTRINSIC
low complexity region 174 187 N/A INTRINSIC
low complexity region 213 235 N/A INTRINSIC
low complexity region 255 280 N/A INTRINSIC
SAP 300 334 4.98e-10 SMART
low complexity region 339 348 N/A INTRINSIC
low complexity region 398 411 N/A INTRINSIC
coiled coil region 473 515 N/A INTRINSIC
low complexity region 585 594 N/A INTRINSIC
low complexity region 629 650 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134469
AA Change: S419N

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000119530
Gene: ENSMUSG00000042292
AA Change: S419N

DomainStartEndE-ValueType
RPEL 24 49 1.36e-8 SMART
RPEL 68 93 1.03e-8 SMART
low complexity region 111 124 N/A INTRINSIC
low complexity region 174 193 N/A INTRINSIC
low complexity region 224 237 N/A INTRINSIC
low complexity region 263 285 N/A INTRINSIC
low complexity region 305 330 N/A INTRINSIC
SAP 350 384 4.98e-10 SMART
low complexity region 389 398 N/A INTRINSIC
low complexity region 448 461 N/A INTRINSIC
coiled coil region 523 565 N/A INTRINSIC
low complexity region 635 644 N/A INTRINSIC
low complexity region 679 700 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000135047
AA Change: S419N

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000118451
Gene: ENSMUSG00000042292
AA Change: S419N

DomainStartEndE-ValueType
RPEL 24 49 1.36e-8 SMART
RPEL 68 93 1.03e-8 SMART
low complexity region 111 124 N/A INTRINSIC
low complexity region 174 193 N/A INTRINSIC
low complexity region 224 237 N/A INTRINSIC
low complexity region 263 285 N/A INTRINSIC
low complexity region 305 330 N/A INTRINSIC
SAP 350 384 4.98e-10 SMART
low complexity region 389 398 N/A INTRINSIC
low complexity region 448 461 N/A INTRINSIC
coiled coil region 523 565 N/A INTRINSIC
low complexity region 635 644 N/A INTRINSIC
low complexity region 679 700 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138769
Predicted Effect probably benign
Transcript: ENSMUST00000149582
AA Change: S419N

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000117745
Gene: ENSMUSG00000042292
AA Change: S419N

DomainStartEndE-ValueType
RPEL 24 49 1.36e-8 SMART
RPEL 68 93 1.03e-8 SMART
low complexity region 111 124 N/A INTRINSIC
low complexity region 174 193 N/A INTRINSIC
low complexity region 224 237 N/A INTRINSIC
low complexity region 263 285 N/A INTRINSIC
low complexity region 305 330 N/A INTRINSIC
SAP 350 384 4.98e-10 SMART
low complexity region 389 398 N/A INTRINSIC
low complexity region 448 461 N/A INTRINSIC
coiled coil region 523 565 N/A INTRINSIC
low complexity region 635 644 N/A INTRINSIC
low complexity region 679 700 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145779
Predicted Effect probably benign
Transcript: ENSMUST00000139517
SMART Domains Protein: ENSMUSP00000122543
Gene: ENSMUSG00000042303

DomainStartEndE-ValueType
TBC 111 328 3.6e-62 SMART
low complexity region 381 391 N/A INTRINSIC
SH3 483 538 6.34e-19 SMART
RUN 654 716 1.29e-21 SMART
Meta Mutation Damage Score 0.0838 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with the transcription factor myocardin, a key regulator of smooth muscle cell differentiation. The encoded protein is predominantly nuclear and may help transduce signals from the cytoskeleton to the nucleus. This gene is involved in a specific translocation event that creates a fusion of this gene and the RNA-binding motif protein-15 gene. This translocation has been associated with acute megakaryocytic leukemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit impaired mammary myoepithelial cell differentiation and fail to eject milk and productively nurse their offspring. Mice homozygous for another null allele show partial embryonic lethality caused by myocardial necrosis as well as mammary gland dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 C T 13: 81,303,350 (GRCm39) W132* probably null Het
Atp8b3 A G 10: 80,360,188 (GRCm39) V961A probably damaging Het
Bglap A C 3: 88,291,712 (GRCm39) I4S unknown Het
Bmp1 T C 14: 70,729,513 (GRCm39) probably null Het
Brd10 G A 19: 29,731,018 (GRCm39) H665Y probably benign Het
Btaf1 T C 19: 36,933,828 (GRCm39) L152P possibly damaging Het
Cacna1b T A 2: 24,527,499 (GRCm39) T1621S possibly damaging Het
Capn3 A T 2: 120,333,479 (GRCm39) N621I probably damaging Het
Ccdc121rt3 A G 5: 112,503,165 (GRCm39) S180P possibly damaging Het
Ccdc59 T C 10: 105,677,429 (GRCm39) S23P probably benign Het
Cd22 A T 7: 30,572,381 (GRCm39) probably null Het
Cdh20 A G 1: 104,868,989 (GRCm39) D160G probably damaging Het
Cep112 T C 11: 108,377,818 (GRCm39) probably null Het
Clock T C 5: 76,413,763 (GRCm39) K44R probably damaging Het
Coq10b A G 1: 55,110,957 (GRCm39) T242A probably damaging Het
Cstdc2 A G 2: 148,692,658 (GRCm39) F48S probably damaging Het
Ctnnd1 G T 2: 84,450,270 (GRCm39) R317S probably damaging Het
Dlg5 G A 14: 24,194,451 (GRCm39) H1674Y probably damaging Het
Drc3 C A 11: 60,254,354 (GRCm39) N75K probably damaging Het
Efna4 T C 3: 89,242,555 (GRCm39) E113G probably damaging Het
Egr3 C A 14: 70,315,024 (GRCm39) A44D probably benign Het
Ercc3 T C 18: 32,381,363 (GRCm39) F393S probably damaging Het
Evi2 T A 11: 79,406,273 (GRCm39) probably benign Het
Fam78b T C 1: 166,906,216 (GRCm39) V125A probably benign Het
Fars2 A T 13: 36,721,400 (GRCm39) E448V probably damaging Het
Farsb A T 1: 78,401,833 (GRCm39) *590R probably null Het
Fat3 A G 9: 15,911,028 (GRCm39) M1658T probably benign Het
Fhod3 G T 18: 25,118,358 (GRCm39) V232F probably damaging Het
Fkbpl G A 17: 34,864,303 (GRCm39) A24T probably benign Het
Fzd3 A G 14: 65,472,607 (GRCm39) V387A possibly damaging Het
Gm1527 A G 3: 28,974,812 (GRCm39) I542V possibly damaging Het
Gm7964 A G 7: 83,405,109 (GRCm39) probably null Het
Hbs1l G T 10: 21,218,405 (GRCm39) G301C probably damaging Het
Hipk4 A G 7: 27,227,995 (GRCm39) H247R probably benign Het
Hmcn1 A G 1: 150,629,362 (GRCm39) V965A probably benign Het
Hoxa5 C T 6: 52,180,943 (GRCm39) A130T probably benign Het
Igf2r C T 17: 12,903,013 (GRCm39) V2346I possibly damaging Het
Igsf8 T C 1: 172,143,889 (GRCm39) V14A probably benign Het
Impg1 G A 9: 80,301,377 (GRCm39) P183L probably damaging Het
Isl1 T C 13: 116,441,966 (GRCm39) N89S probably benign Het
Itga1 C A 13: 115,171,921 (GRCm39) W61C probably damaging Het
Itga5 T C 15: 103,256,187 (GRCm39) R922G probably benign Het
Itgb5 T C 16: 33,705,391 (GRCm39) V227A possibly damaging Het
Jph4 G T 14: 55,347,165 (GRCm39) P461T probably damaging Het
Kcnab1 T A 3: 65,211,586 (GRCm39) probably null Het
Klrc1 T A 6: 129,654,725 (GRCm39) probably null Het
Lonrf2 A T 1: 38,855,119 (GRCm39) L92Q probably benign Het
Ly75 T C 2: 60,180,284 (GRCm39) E631G probably benign Het
Mapk13 T C 17: 28,994,528 (GRCm39) Y140H probably damaging Het
Meak7 A T 8: 120,495,093 (GRCm39) S222T probably benign Het
Mgat4d A G 8: 84,084,749 (GRCm39) E164G probably damaging Het
Mtcl2 A G 2: 156,862,172 (GRCm39) S1586P probably benign Het
Mthfs A T 9: 89,122,078 (GRCm39) H188L probably benign Het
Muc5b T A 7: 141,417,983 (GRCm39) M3643K possibly damaging Het
Mylk3 T C 8: 86,077,014 (GRCm39) Y474C probably damaging Het
Myo5b A G 18: 74,877,701 (GRCm39) T1567A possibly damaging Het
Ncaph2 T G 15: 89,255,010 (GRCm39) V478G probably damaging Het
Ncbp1 A G 4: 46,152,967 (GRCm39) R247G possibly damaging Het
Nedd9 T C 13: 41,471,376 (GRCm39) K208E probably benign Het
Nxph2 C T 2: 23,289,870 (GRCm39) T74M probably benign Het
Ogdh T A 11: 6,290,570 (GRCm39) M385K probably benign Het
Or10a5 A T 7: 106,636,121 (GRCm39) Y253F probably benign Het
Or3a1c A T 11: 74,046,417 (GRCm39) I146F probably benign Het
Or4a2 T C 2: 89,248,235 (GRCm39) H174R probably damaging Het
Or6a2 C T 7: 106,600,542 (GRCm39) G175D probably damaging Het
Or7g18 T C 9: 18,787,475 (GRCm39) V284A probably damaging Het
Or8b54 T A 9: 38,686,670 (GRCm39) F40I probably benign Het
Pcsk2 A C 2: 143,655,345 (GRCm39) I510L probably benign Het
Pdgfra A G 5: 75,349,972 (GRCm39) N952S probably benign Het
Pex26 T C 6: 121,170,516 (GRCm39) F287S probably damaging Het
Pick1 G C 15: 79,139,810 (GRCm39) probably benign Het
Plxnb1 G T 9: 108,943,663 (GRCm39) V1917L probably damaging Het
Polk T C 13: 96,625,764 (GRCm39) T347A probably benign Het
Ppp1r10 T G 17: 36,234,979 (GRCm39) I61R probably damaging Het
Prex1 A T 2: 166,434,211 (GRCm39) L503Q probably damaging Het
Ptp4a1 A C 1: 30,983,019 (GRCm39) I133R probably damaging Het
Rassf10 G T 7: 112,553,735 (GRCm39) R112L probably damaging Het
Ripor3 T A 2: 167,823,260 (GRCm39) I884F probably damaging Het
Rnft2 A G 5: 118,339,311 (GRCm39) Y369H probably damaging Het
Rtp3 A T 9: 110,815,522 (GRCm39) V281E probably benign Het
Runx1t1 T A 4: 13,837,767 (GRCm39) N51K probably damaging Het
Selp A G 1: 163,972,475 (GRCm39) T705A probably benign Het
Sgca A T 11: 94,861,553 (GRCm39) probably null Het
Slc22a3 T C 17: 12,642,675 (GRCm39) E514G probably damaging Het
Slc28a2b T A 2: 122,344,940 (GRCm39) I182N probably damaging Het
Slc2a1 G A 4: 118,989,642 (GRCm39) R61Q probably damaging Het
Smarcal1 G A 1: 72,636,599 (GRCm39) V425I probably benign Het
Ssx2ip T C 3: 146,124,114 (GRCm39) V43A probably benign Het
Synpo A G 18: 60,737,386 (GRCm39) S187P probably damaging Het
Thnsl1 T A 2: 21,216,856 (GRCm39) C203* probably null Het
Ttyh3 A T 5: 140,620,541 (GRCm39) I232N probably damaging Het
Upk1b T C 16: 38,607,604 (GRCm39) H41R probably benign Het
Vmn2r76 T C 7: 85,879,652 (GRCm39) D216G possibly damaging Het
Zan A T 5: 137,379,112 (GRCm39) C5329* probably null Het
Zbtb40 C T 4: 136,725,953 (GRCm39) M535I probably benign Het
Zfp383 A C 7: 29,614,263 (GRCm39) T173P possibly damaging Het
Zfp7 T A 15: 76,775,546 (GRCm39) C529* probably null Het
Other mutations in Mrtfa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01344:Mrtfa APN 15 80,900,503 (GRCm39) missense probably damaging 1.00
IGL02831:Mrtfa APN 15 80,988,994 (GRCm39) missense probably benign 0.14
IGL03060:Mrtfa APN 15 80,929,523 (GRCm39) missense probably damaging 1.00
Betcha UTSW 15 80,902,649 (GRCm39) nonsense probably null
R0594:Mrtfa UTSW 15 80,901,375 (GRCm39) missense probably damaging 1.00
R0648:Mrtfa UTSW 15 80,901,121 (GRCm39) missense probably damaging 1.00
R1085:Mrtfa UTSW 15 80,905,084 (GRCm39) missense probably damaging 1.00
R1476:Mrtfa UTSW 15 80,902,409 (GRCm39) splice site probably benign
R4030:Mrtfa UTSW 15 80,899,985 (GRCm39) missense probably benign 0.01
R4232:Mrtfa UTSW 15 80,907,796 (GRCm39) missense probably damaging 1.00
R4307:Mrtfa UTSW 15 80,900,548 (GRCm39) missense possibly damaging 0.88
R4400:Mrtfa UTSW 15 80,905,124 (GRCm39) nonsense probably null
R4795:Mrtfa UTSW 15 80,901,234 (GRCm39) missense probably damaging 0.97
R4801:Mrtfa UTSW 15 80,989,000 (GRCm39) missense probably benign 0.15
R4802:Mrtfa UTSW 15 80,989,000 (GRCm39) missense probably benign 0.15
R4899:Mrtfa UTSW 15 80,902,587 (GRCm39) missense probably damaging 1.00
R4967:Mrtfa UTSW 15 80,929,476 (GRCm39) splice site probably benign
R5071:Mrtfa UTSW 15 80,906,627 (GRCm39) missense probably damaging 1.00
R5072:Mrtfa UTSW 15 80,906,627 (GRCm39) missense probably damaging 1.00
R5073:Mrtfa UTSW 15 80,906,627 (GRCm39) missense probably damaging 1.00
R5074:Mrtfa UTSW 15 80,906,627 (GRCm39) missense probably damaging 1.00
R6186:Mrtfa UTSW 15 80,900,853 (GRCm39) missense probably damaging 1.00
R6512:Mrtfa UTSW 15 80,897,917 (GRCm39) missense probably benign
R6581:Mrtfa UTSW 15 80,900,574 (GRCm39) missense probably damaging 1.00
R6997:Mrtfa UTSW 15 80,902,649 (GRCm39) nonsense probably null
R8773:Mrtfa UTSW 15 80,902,274 (GRCm39) missense possibly damaging 0.68
R8834:Mrtfa UTSW 15 80,904,511 (GRCm39) missense probably benign 0.00
R9742:Mrtfa UTSW 15 80,901,180 (GRCm39) missense possibly damaging 0.89
RF023:Mrtfa UTSW 15 80,900,057 (GRCm39) missense probably damaging 1.00
RF024:Mrtfa UTSW 15 80,902,456 (GRCm39) small deletion probably benign
X0013:Mrtfa UTSW 15 80,906,637 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTCACCATTTCACCAAAGGC -3'
(R):5'- TAACTCTCAACCCCTGCAGG -3'

Sequencing Primer
(F):5'- AAAGGCATCCCCAGGTGTG -3'
(R):5'- CTGAAGCAAGAACTGAAGTTGC -3'
Posted On 2016-02-04