Incidental Mutation 'R4796:Itgb5'
ID 369093
Institutional Source Beutler Lab
Gene Symbol Itgb5
Ensembl Gene ENSMUSG00000022817
Gene Name integrin beta 5
Synonyms beta5, [b]5B, [b]5, ESTM23, [b]-5, [b]5A, beta-5
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4796 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 33650035-33769708 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 33705391 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 227 (V227A)
Ref Sequence ENSEMBL: ENSMUSP00000069416 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069345] [ENSMUST00000115028]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000069345
AA Change: V227A

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000069416
Gene: ENSMUSG00000022817
AA Change: V227A

DomainStartEndE-ValueType
PSI 27 76 1.4e-7 SMART
INB 35 463 1.18e-284 SMART
VWA 137 372 5.95e-7 SMART
internal_repeat_1 492 549 3.16e-7 PROSPERO
EGF 554 586 1.95e1 SMART
Integrin_B_tail 635 719 1.56e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115028
AA Change: V227A

PolyPhen 2 Score 0.292 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000110680
Gene: ENSMUSG00000022817
AA Change: V227A

DomainStartEndE-ValueType
PSI 27 76 1.4e-7 SMART
INB 35 463 1.18e-284 SMART
VWA 137 372 5.95e-7 SMART
internal_repeat_1 492 549 3.16e-7 PROSPERO
EGF 554 586 1.95e1 SMART
Integrin_B_tail 635 719 1.56e-21 SMART
Integrin_b_cyt 743 790 5.97e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134262
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation do not appear to differ from normal in respect to development, reproduction, adenovirus infection, or wound healing. Mutant keratinocytes do show reduced migration on, and adhesion to, vitronectin in vitro. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 C T 13: 81,303,350 (GRCm39) W132* probably null Het
Atp8b3 A G 10: 80,360,188 (GRCm39) V961A probably damaging Het
Bglap A C 3: 88,291,712 (GRCm39) I4S unknown Het
Bmp1 T C 14: 70,729,513 (GRCm39) probably null Het
Brd10 G A 19: 29,731,018 (GRCm39) H665Y probably benign Het
Btaf1 T C 19: 36,933,828 (GRCm39) L152P possibly damaging Het
Cacna1b T A 2: 24,527,499 (GRCm39) T1621S possibly damaging Het
Capn3 A T 2: 120,333,479 (GRCm39) N621I probably damaging Het
Ccdc121rt3 A G 5: 112,503,165 (GRCm39) S180P possibly damaging Het
Ccdc59 T C 10: 105,677,429 (GRCm39) S23P probably benign Het
Cd22 A T 7: 30,572,381 (GRCm39) probably null Het
Cdh20 A G 1: 104,868,989 (GRCm39) D160G probably damaging Het
Cep112 T C 11: 108,377,818 (GRCm39) probably null Het
Clock T C 5: 76,413,763 (GRCm39) K44R probably damaging Het
Coq10b A G 1: 55,110,957 (GRCm39) T242A probably damaging Het
Cstdc2 A G 2: 148,692,658 (GRCm39) F48S probably damaging Het
Ctnnd1 G T 2: 84,450,270 (GRCm39) R317S probably damaging Het
Dlg5 G A 14: 24,194,451 (GRCm39) H1674Y probably damaging Het
Drc3 C A 11: 60,254,354 (GRCm39) N75K probably damaging Het
Efna4 T C 3: 89,242,555 (GRCm39) E113G probably damaging Het
Egr3 C A 14: 70,315,024 (GRCm39) A44D probably benign Het
Ercc3 T C 18: 32,381,363 (GRCm39) F393S probably damaging Het
Evi2 T A 11: 79,406,273 (GRCm39) probably benign Het
Fam78b T C 1: 166,906,216 (GRCm39) V125A probably benign Het
Fars2 A T 13: 36,721,400 (GRCm39) E448V probably damaging Het
Farsb A T 1: 78,401,833 (GRCm39) *590R probably null Het
Fat3 A G 9: 15,911,028 (GRCm39) M1658T probably benign Het
Fhod3 G T 18: 25,118,358 (GRCm39) V232F probably damaging Het
Fkbpl G A 17: 34,864,303 (GRCm39) A24T probably benign Het
Fzd3 A G 14: 65,472,607 (GRCm39) V387A possibly damaging Het
Gm1527 A G 3: 28,974,812 (GRCm39) I542V possibly damaging Het
Gm7964 A G 7: 83,405,109 (GRCm39) probably null Het
Hbs1l G T 10: 21,218,405 (GRCm39) G301C probably damaging Het
Hipk4 A G 7: 27,227,995 (GRCm39) H247R probably benign Het
Hmcn1 A G 1: 150,629,362 (GRCm39) V965A probably benign Het
Hoxa5 C T 6: 52,180,943 (GRCm39) A130T probably benign Het
Igf2r C T 17: 12,903,013 (GRCm39) V2346I possibly damaging Het
Igsf8 T C 1: 172,143,889 (GRCm39) V14A probably benign Het
Impg1 G A 9: 80,301,377 (GRCm39) P183L probably damaging Het
Isl1 T C 13: 116,441,966 (GRCm39) N89S probably benign Het
Itga1 C A 13: 115,171,921 (GRCm39) W61C probably damaging Het
Itga5 T C 15: 103,256,187 (GRCm39) R922G probably benign Het
Jph4 G T 14: 55,347,165 (GRCm39) P461T probably damaging Het
Kcnab1 T A 3: 65,211,586 (GRCm39) probably null Het
Klrc1 T A 6: 129,654,725 (GRCm39) probably null Het
Lonrf2 A T 1: 38,855,119 (GRCm39) L92Q probably benign Het
Ly75 T C 2: 60,180,284 (GRCm39) E631G probably benign Het
Mapk13 T C 17: 28,994,528 (GRCm39) Y140H probably damaging Het
Meak7 A T 8: 120,495,093 (GRCm39) S222T probably benign Het
Mgat4d A G 8: 84,084,749 (GRCm39) E164G probably damaging Het
Mrtfa C T 15: 80,901,234 (GRCm39) S419N probably damaging Het
Mtcl2 A G 2: 156,862,172 (GRCm39) S1586P probably benign Het
Mthfs A T 9: 89,122,078 (GRCm39) H188L probably benign Het
Muc5b T A 7: 141,417,983 (GRCm39) M3643K possibly damaging Het
Mylk3 T C 8: 86,077,014 (GRCm39) Y474C probably damaging Het
Myo5b A G 18: 74,877,701 (GRCm39) T1567A possibly damaging Het
Ncaph2 T G 15: 89,255,010 (GRCm39) V478G probably damaging Het
Ncbp1 A G 4: 46,152,967 (GRCm39) R247G possibly damaging Het
Nedd9 T C 13: 41,471,376 (GRCm39) K208E probably benign Het
Nxph2 C T 2: 23,289,870 (GRCm39) T74M probably benign Het
Ogdh T A 11: 6,290,570 (GRCm39) M385K probably benign Het
Or10a5 A T 7: 106,636,121 (GRCm39) Y253F probably benign Het
Or3a1c A T 11: 74,046,417 (GRCm39) I146F probably benign Het
Or4a2 T C 2: 89,248,235 (GRCm39) H174R probably damaging Het
Or6a2 C T 7: 106,600,542 (GRCm39) G175D probably damaging Het
Or7g18 T C 9: 18,787,475 (GRCm39) V284A probably damaging Het
Or8b54 T A 9: 38,686,670 (GRCm39) F40I probably benign Het
Pcsk2 A C 2: 143,655,345 (GRCm39) I510L probably benign Het
Pdgfra A G 5: 75,349,972 (GRCm39) N952S probably benign Het
Pex26 T C 6: 121,170,516 (GRCm39) F287S probably damaging Het
Pick1 G C 15: 79,139,810 (GRCm39) probably benign Het
Plxnb1 G T 9: 108,943,663 (GRCm39) V1917L probably damaging Het
Polk T C 13: 96,625,764 (GRCm39) T347A probably benign Het
Ppp1r10 T G 17: 36,234,979 (GRCm39) I61R probably damaging Het
Prex1 A T 2: 166,434,211 (GRCm39) L503Q probably damaging Het
Ptp4a1 A C 1: 30,983,019 (GRCm39) I133R probably damaging Het
Rassf10 G T 7: 112,553,735 (GRCm39) R112L probably damaging Het
Ripor3 T A 2: 167,823,260 (GRCm39) I884F probably damaging Het
Rnft2 A G 5: 118,339,311 (GRCm39) Y369H probably damaging Het
Rtp3 A T 9: 110,815,522 (GRCm39) V281E probably benign Het
Runx1t1 T A 4: 13,837,767 (GRCm39) N51K probably damaging Het
Selp A G 1: 163,972,475 (GRCm39) T705A probably benign Het
Sgca A T 11: 94,861,553 (GRCm39) probably null Het
Slc22a3 T C 17: 12,642,675 (GRCm39) E514G probably damaging Het
Slc28a2b T A 2: 122,344,940 (GRCm39) I182N probably damaging Het
Slc2a1 G A 4: 118,989,642 (GRCm39) R61Q probably damaging Het
Smarcal1 G A 1: 72,636,599 (GRCm39) V425I probably benign Het
Ssx2ip T C 3: 146,124,114 (GRCm39) V43A probably benign Het
Synpo A G 18: 60,737,386 (GRCm39) S187P probably damaging Het
Thnsl1 T A 2: 21,216,856 (GRCm39) C203* probably null Het
Ttyh3 A T 5: 140,620,541 (GRCm39) I232N probably damaging Het
Upk1b T C 16: 38,607,604 (GRCm39) H41R probably benign Het
Vmn2r76 T C 7: 85,879,652 (GRCm39) D216G possibly damaging Het
Zan A T 5: 137,379,112 (GRCm39) C5329* probably null Het
Zbtb40 C T 4: 136,725,953 (GRCm39) M535I probably benign Het
Zfp383 A C 7: 29,614,263 (GRCm39) T173P possibly damaging Het
Zfp7 T A 15: 76,775,546 (GRCm39) C529* probably null Het
Other mutations in Itgb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Itgb5 APN 16 33,705,345 (GRCm39) missense probably damaging 1.00
IGL01121:Itgb5 APN 16 33,740,359 (GRCm39) missense probably benign 0.00
IGL01620:Itgb5 APN 16 33,740,168 (GRCm39) missense probably damaging 1.00
IGL02332:Itgb5 APN 16 33,740,500 (GRCm39) nonsense probably null
IGL02869:Itgb5 APN 16 33,665,362 (GRCm39) missense possibly damaging 0.94
IGL02881:Itgb5 APN 16 33,740,275 (GRCm39) missense probably benign 0.00
IGL02941:Itgb5 APN 16 33,764,465 (GRCm39) splice site probably benign
IGL03216:Itgb5 APN 16 33,723,208 (GRCm39) missense probably benign 0.38
IGL03351:Itgb5 APN 16 33,730,922 (GRCm39) missense probably benign 0.00
PIT4812001:Itgb5 UTSW 16 33,740,357 (GRCm39) missense probably damaging 1.00
R0744:Itgb5 UTSW 16 33,720,953 (GRCm39) missense probably damaging 0.99
R0829:Itgb5 UTSW 16 33,764,571 (GRCm39) missense probably benign 0.29
R0836:Itgb5 UTSW 16 33,720,953 (GRCm39) missense probably damaging 0.99
R1387:Itgb5 UTSW 16 33,720,885 (GRCm39) nonsense probably null
R1703:Itgb5 UTSW 16 33,730,870 (GRCm39) missense probably benign 0.01
R1783:Itgb5 UTSW 16 33,760,932 (GRCm39) missense probably benign 0.13
R1826:Itgb5 UTSW 16 33,685,930 (GRCm39) missense possibly damaging 0.48
R1889:Itgb5 UTSW 16 33,730,839 (GRCm39) missense probably damaging 1.00
R2374:Itgb5 UTSW 16 33,740,168 (GRCm39) missense probably damaging 1.00
R4307:Itgb5 UTSW 16 33,769,102 (GRCm39) missense possibly damaging 0.80
R4355:Itgb5 UTSW 16 33,665,367 (GRCm39) missense probably damaging 0.98
R4879:Itgb5 UTSW 16 33,696,348 (GRCm39) missense probably damaging 1.00
R6165:Itgb5 UTSW 16 33,719,612 (GRCm39) missense probably benign 0.01
R6584:Itgb5 UTSW 16 33,705,400 (GRCm39) missense probably damaging 1.00
R6617:Itgb5 UTSW 16 33,766,962 (GRCm39) missense probably benign 0.01
R6748:Itgb5 UTSW 16 33,719,667 (GRCm39) missense probably damaging 1.00
R6979:Itgb5 UTSW 16 33,740,356 (GRCm39) missense probably damaging 1.00
R7090:Itgb5 UTSW 16 33,705,464 (GRCm39) missense probably damaging 1.00
R7150:Itgb5 UTSW 16 33,761,013 (GRCm39) missense probably benign 0.03
R7403:Itgb5 UTSW 16 33,723,163 (GRCm39) critical splice acceptor site probably null
R7418:Itgb5 UTSW 16 33,705,464 (GRCm39) missense probably damaging 1.00
R7719:Itgb5 UTSW 16 33,740,486 (GRCm39) missense probably benign 0.01
R8309:Itgb5 UTSW 16 33,685,923 (GRCm39) missense probably benign 0.00
R8347:Itgb5 UTSW 16 33,761,048 (GRCm39) missense probably damaging 1.00
R8856:Itgb5 UTSW 16 33,720,962 (GRCm39) missense probably damaging 1.00
R9100:Itgb5 UTSW 16 33,740,551 (GRCm39) missense possibly damaging 0.91
R9194:Itgb5 UTSW 16 33,720,881 (GRCm39) missense probably damaging 1.00
R9309:Itgb5 UTSW 16 33,740,416 (GRCm39) missense probably benign 0.00
R9343:Itgb5 UTSW 16 33,730,826 (GRCm39) splice site probably benign
R9629:Itgb5 UTSW 16 33,696,295 (GRCm39) missense probably damaging 1.00
R9683:Itgb5 UTSW 16 33,740,335 (GRCm39) missense probably damaging 0.97
R9710:Itgb5 UTSW 16 33,685,917 (GRCm39) missense probably benign 0.00
X0022:Itgb5 UTSW 16 33,665,420 (GRCm39) missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- GGTACTTAGTGAAGGCCAGG -3'
(R):5'- TAGAGATTCCGCCATGGTGC -3'

Sequencing Primer
(F):5'- GTGGCTCACAACCATCTGTAATGG -3'
(R):5'- ATGGTGCGGCTGAGCTCAG -3'
Posted On 2016-02-04