Mutagenetix > Incidental Mutation

Incidental Mutation 'R4796:Btaf1'

369106

Institutional Source

Beutler Lab

Gene Symbol

Btaf1

Ensembl Gene

ENSMUSG00000040565

Gene Name

B-TFIID TATA-box binding protein associated factor 1

Synonyms

E430027O22Rik

Accession Numbers

Genbank: NM_001080706

Essential gene?

Probably essential (E-score: 0.969) question?

Stock #

R4796 (G1)

Quality Score

199

Status

Not validated

Chromosome

Chromosomal Location

36926079-37012752 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 36956428 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 152 (L152P)

Ref Sequence

ENSEMBL: ENSMUSP00000097093 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099494]

AlphaFold

E9QAE3

Predicted Effect

possibly damaging
Transcript: ENSMUST00000099494
AA Change: L152P

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000097093
Gene: ENSMUSG00000040565
AA Change: L152P

Domain	Start	End	E-Value	Type
low complexity region	87	98	N/A	INTRINSIC
low complexity region	143	152	N/A	INTRINSIC
PDB:3OC3\|B	276	414	3e-6	PDB
low complexity region	438	454	N/A	INTRINSIC
Pfam:DUF3535	585	1051	1.1e-133	PFAM
low complexity region	1099	1110	N/A	INTRINSIC
low complexity region	1177	1192	N/A	INTRINSIC
DEXDc	1261	1469	3.02e-30	SMART
low complexity region	1630	1641	N/A	INTRINSIC
HELICc	1657	1743	2.22e-19	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a TAF (TATA box-binding protein-associated factor), which associates with TBP (TATA box-binding protein) to form the B-TFIID complex that is required for transcription initiation of genes by RNA polymerase II. This TAF has DNA-dependent ATPase activity, which drives the dissociation of TBP from DNA, freeing the TBP to associate with other TATA boxes or TATA-less promoters. [provided by RefSeq, Sep 2011]
PHENOTYPE: Embryos homozygous for a gene-trapped allele display growth retardation. Embryos homozygous for an ENU-induced allele show growth retardation, edema, abnormal blood circulation, myocardial trabeculae hypoplasia, and delayed head and brain development. [provided by MGI curators]

Allele List at MGI

All alleles(40) : Gene trapped(40)

Other mutations in this stock

Total: 97 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9230104L09Rik	A	G	2: 148,850,738	F48S	probably damaging	Het
9930021J03Rik	G	A	19: 29,753,618	H665Y	probably benign	Het
Adgrv1	C	T	13: 81,155,231	W132*	probably null	Het
Atp8b3	A	G	10: 80,524,354	V961A	probably damaging	Het
Bglap	A	C	3: 88,384,405	I4S	unknown	Het
Bmp1	T	C	14: 70,492,073		probably null	Het
Cacna1b	T	A	2: 24,637,487	T1621S	possibly damaging	Het
Capn3	A	T	2: 120,502,998	N621I	probably damaging	Het
Ccdc59	T	C	10: 105,841,568	S23P	probably benign	Het
Cd22	A	T	7: 30,872,956		probably null	Het
Cdh20	A	G	1: 104,941,264	D160G	probably damaging	Het
Cep112	T	C	11: 108,486,992		probably null	Het
Clock	T	C	5: 76,265,916	K44R	probably damaging	Het
Coq10b	A	G	1: 55,071,798	T242A	probably damaging	Het
Ctnnd1	G	T	2: 84,619,926	R317S	probably damaging	Het
Dlg5	G	A	14: 24,144,383	H1674Y	probably damaging	Het
Drc3	C	A	11: 60,363,528	N75K	probably damaging	Het
Efna4	T	C	3: 89,335,248	E113G	probably damaging	Het
Egr3	C	A	14: 70,077,575	A44D	probably benign	Het
Ercc3	T	C	18: 32,248,310	F393S	probably damaging	Het
Evi2	T	A	11: 79,515,447		probably benign	Het
Fam78b	T	C	1: 167,078,647	V125A	probably benign	Het
Fars2	A	T	13: 36,537,426	E448V	probably damaging	Het
Farsb	A	T	1: 78,425,196	*590R	probably null	Het
Fat3	A	G	9: 15,999,732	M1658T	probably benign	Het
Fhod3	G	T	18: 24,985,301	V232F	probably damaging	Het
Fkbpl	G	A	17: 34,645,329	A24T	probably benign	Het
Fzd3	A	G	14: 65,235,158	V387A	possibly damaging	Het
Gm14085	T	A	2: 122,514,459	I182N	probably damaging	Het
Gm1527	A	G	3: 28,920,663	I542V	possibly damaging	Het
Gm6583	A	G	5: 112,355,299	S180P	possibly damaging	Het
Gm7964	A	G	7: 83,755,901		probably null	Het
Hbs1l	G	T	10: 21,342,506	G301C	probably damaging	Het
Hipk4	A	G	7: 27,528,570	H247R	probably benign	Het
Hmcn1	A	G	1: 150,753,611	V965A	probably benign	Het
Hoxa5	C	T	6: 52,203,963	A130T	probably benign	Het
Igf2r	C	T	17: 12,684,126	V2346I	possibly damaging	Het
Igsf8	T	C	1: 172,316,322	V14A	probably benign	Het
Impg1	G	A	9: 80,394,095	P183L	probably damaging	Het
Isl1	T	C	13: 116,305,430	N89S	probably benign	Het
Itga1	C	A	13: 115,035,385	W61C	probably damaging	Het
Itga5	T	C	15: 103,347,760	R922G	probably benign	Het
Itgb5	T	C	16: 33,885,021	V227A	possibly damaging	Het
Jph4	G	T	14: 55,109,708	P461T	probably damaging	Het
Kcnab1	T	A	3: 65,304,165		probably null	Het
Klrc1	T	A	6: 129,677,762		probably null	Het
Lonrf2	A	T	1: 38,816,038	L92Q	probably benign	Het
Ly75	T	C	2: 60,349,940	E631G	probably benign	Het
Mapk13	T	C	17: 28,775,554	Y140H	probably damaging	Het
Mgat4d	A	G	8: 83,358,120	E164G	probably damaging	Het
Mkl1	C	T	15: 81,017,033	S419N	probably damaging	Het
Mthfs	A	T	9: 89,240,025	H188L	probably benign	Het
Muc5b	T	A	7: 141,864,246	M3643K	possibly damaging	Het
Mylk3	T	C	8: 85,350,385	Y474C	probably damaging	Het
Myo5b	A	G	18: 74,744,630	T1567A	possibly damaging	Het
Ncaph2	T	G	15: 89,370,807	V478G	probably damaging	Het
Ncbp1	A	G	4: 46,152,967	R247G	possibly damaging	Het
Nedd9	T	C	13: 41,317,900	K208E	probably benign	Het
Nxph2	C	T	2: 23,399,858	T74M	probably benign	Het
Ogdh	T	A	11: 6,340,570	M385K	probably benign	Het
Olfr1239	T	C	2: 89,417,891	H174R	probably damaging	Het
Olfr2	C	T	7: 107,001,335	G175D	probably damaging	Het
Olfr402	A	T	11: 74,155,591	I146F	probably benign	Het
Olfr713	A	T	7: 107,036,914	Y253F	probably benign	Het
Olfr830	T	C	9: 18,876,179	V284A	probably damaging	Het
Olfr921	T	A	9: 38,775,374	F40I	probably benign	Het
Pcsk2	A	C	2: 143,813,425	I510L	probably benign	Het
Pdgfra	A	G	5: 75,189,311	N952S	probably benign	Het
Pex26	T	C	6: 121,193,557	F287S	probably damaging	Het
Pick1	G	C	15: 79,255,610		probably benign	Het
Plxnb1	G	T	9: 109,114,595	V1917L	probably damaging	Het
Polk	T	C	13: 96,489,256	T347A	probably benign	Het
Ppp1r10	T	G	17: 35,924,087	I61R	probably damaging	Het
Prex1	A	T	2: 166,592,291	L503Q	probably damaging	Het
Ptp4a1	A	C	1: 30,943,938	I133R	probably damaging	Het
Rassf10	G	T	7: 112,954,528	R112L	probably damaging	Het
Ripor3	T	A	2: 167,981,340	I884F	probably damaging	Het
Rnft2	A	G	5: 118,201,246	Y369H	probably damaging	Het
Rtp3	A	T	9: 110,986,454	V281E	probably benign	Het
Runx1t1	T	A	4: 13,837,767	N51K	probably damaging	Het
Selp	A	G	1: 164,144,906	T705A	probably benign	Het
Sgca	A	T	11: 94,970,727		probably null	Het
Slc22a3	T	C	17: 12,423,788	E514G	probably damaging	Het
Slc2a1	G	A	4: 119,132,445	R61Q	probably damaging	Het
Smarcal1	G	A	1: 72,597,440	V425I	probably benign	Het
Soga1	A	G	2: 157,020,252	S1586P	probably benign	Het
Ssx2ip	T	C	3: 146,418,359	V43A	probably benign	Het
Synpo	A	G	18: 60,604,314	S187P	probably damaging	Het
Thnsl1	T	A	2: 21,212,045	C203*	probably null	Het
Tldc1	A	T	8: 119,768,354	S222T	probably benign	Het
Ttyh3	A	T	5: 140,634,786	I232N	probably damaging	Het
Upk1b	T	C	16: 38,787,242	H41R	probably benign	Het
Vmn2r76	T	C	7: 86,230,444	D216G	possibly damaging	Het
Zan	A	T	5: 137,380,850	C5329*	probably null	Het
Zbtb40	C	T	4: 136,998,642	M535I	probably benign	Het
Zfp383	A	C	7: 29,914,838	T173P	possibly damaging	Het
Zfp7	T	A	15: 76,891,346	C529*	probably null	Het

Other mutations in Btaf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00392:Btaf1	APN	19	37009702	missense	probably damaging	1.00
IGL00535:Btaf1	APN	19	36997535	missense	probably damaging	1.00
IGL00574:Btaf1	APN	19	36969930	missense	probably benign	0.00
IGL00969:Btaf1	APN	19	37011252	splice site	probably benign
IGL01325:Btaf1	APN	19	37004649	splice site	probably benign
IGL01399:Btaf1	APN	19	37000170	nonsense	probably null
IGL02024:Btaf1	APN	19	36992426	splice site	probably benign
IGL02471:Btaf1	APN	19	37000192	missense	probably damaging	0.96
IGL02664:Btaf1	APN	19	36978428	splice site	probably benign
IGL02898:Btaf1	APN	19	36969068	missense	probably benign
IGL02995:Btaf1	APN	19	36981135	splice site	probably benign
IGL03023:Btaf1	APN	19	37010015	missense	possibly damaging	0.85
IGL03188:Btaf1	APN	19	36949108	missense	possibly damaging	0.91
IGL03353:Btaf1	APN	19	36992500	missense	probably damaging	1.00
freudenberg	UTSW	19	36988173	critical splice donor site	probably null
Galanos	UTSW	19	36949102	missense	probably damaging	1.00
3-1:Btaf1	UTSW	19	37010078	missense	probably damaging	1.00
R0013:Btaf1	UTSW	19	36958373	missense	probably benign
R0048:Btaf1	UTSW	19	37003524	missense	probably benign	0.01
R0117:Btaf1	UTSW	19	36969968	missense	probably benign	0.06
R0207:Btaf1	UTSW	19	37009648	nonsense	probably null
R0310:Btaf1	UTSW	19	37004534	missense	probably damaging	0.96
R0377:Btaf1	UTSW	19	36989002	missense	probably benign
R0419:Btaf1	UTSW	19	36945229	missense	probably damaging	0.99
R0440:Btaf1	UTSW	19	36986653	missense	probably damaging	0.99
R0532:Btaf1	UTSW	19	36951186	splice site	probably benign
R0612:Btaf1	UTSW	19	36969137	missense	probably damaging	0.99
R0731:Btaf1	UTSW	19	36997495	splice site	probably null
R0780:Btaf1	UTSW	19	36988922	missense	probably damaging	0.99
R0919:Btaf1	UTSW	19	36990743	missense	probably benign	0.03
R1104:Btaf1	UTSW	19	37004602	missense	probably damaging	1.00
R1263:Btaf1	UTSW	19	36956524	missense	probably benign	0.10
R1325:Btaf1	UTSW	19	36969162	missense	possibly damaging	0.68
R1447:Btaf1	UTSW	19	36992454	missense	probably benign	0.00
R1554:Btaf1	UTSW	19	36996598	missense	probably benign	0.02
R1649:Btaf1	UTSW	19	36981722	missense	probably benign
R1715:Btaf1	UTSW	19	36969121	missense	probably damaging	0.99
R1733:Btaf1	UTSW	19	36994962	missense	probably benign
R1764:Btaf1	UTSW	19	36951118	missense	probably benign	0.12
R1874:Btaf1	UTSW	19	36980583	missense	probably benign
R1911:Btaf1	UTSW	19	36986630	missense	probably benign
R1933:Btaf1	UTSW	19	36972957	missense	probably damaging	1.00
R2080:Btaf1	UTSW	19	36951148	missense	probably benign	0.09
R2483:Btaf1	UTSW	19	36981086	missense	probably benign	0.02
R2510:Btaf1	UTSW	19	37002445	missense	probably benign	0.08
R3623:Btaf1	UTSW	19	36981086	missense	probably benign	0.02
R3624:Btaf1	UTSW	19	36981086	missense	probably benign	0.02
R3801:Btaf1	UTSW	19	36986548	missense	probably benign
R3801:Btaf1	UTSW	19	36988973	missense	probably benign	0.00
R3802:Btaf1	UTSW	19	36986548	missense	probably benign
R3802:Btaf1	UTSW	19	36988973	missense	probably benign	0.00
R3803:Btaf1	UTSW	19	36986548	missense	probably benign
R3803:Btaf1	UTSW	19	36988973	missense	probably benign	0.00
R4077:Btaf1	UTSW	19	36986479	missense	probably benign	0.00
R4079:Btaf1	UTSW	19	36986479	missense	probably benign	0.00
R4133:Btaf1	UTSW	19	36961738	missense	probably benign	0.00
R4673:Btaf1	UTSW	19	36978372	missense	probably benign	0.00
R4731:Btaf1	UTSW	19	36981078	missense	probably benign	0.03
R4824:Btaf1	UTSW	19	36981048	missense	possibly damaging	0.84
R4835:Btaf1	UTSW	19	37002458	missense	probably benign	0.00
R4837:Btaf1	UTSW	19	36966785	missense	probably benign
R4925:Btaf1	UTSW	19	37011333	missense	probably benign
R4968:Btaf1	UTSW	19	36969951	missense	probably null	0.71
R4976:Btaf1	UTSW	19	36986579	missense	probably benign
R5001:Btaf1	UTSW	19	36986652	missense	possibly damaging	0.90
R5037:Btaf1	UTSW	19	37003531	missense	probably damaging	1.00
R5039:Btaf1	UTSW	19	36990762	missense	probably benign
R5211:Btaf1	UTSW	19	36996562	missense	probably benign	0.32
R5422:Btaf1	UTSW	19	36951107	missense	probably benign	0.09
R5429:Btaf1	UTSW	19	36994857	missense	possibly damaging	0.58
R5530:Btaf1	UTSW	19	36990775	missense	possibly damaging	0.85
R5582:Btaf1	UTSW	19	36988173	critical splice donor site	probably null
R5654:Btaf1	UTSW	19	36983615	missense	probably benign	0.35
R5744:Btaf1	UTSW	19	37004490	missense	probably benign	0.02
R6082:Btaf1	UTSW	19	36983542	missense	probably damaging	1.00
R6243:Btaf1	UTSW	19	36981120	missense	probably benign	0.02
R6291:Btaf1	UTSW	19	36973008	missense	probably benign	0.00
R6502:Btaf1	UTSW	19	36983617	missense	probably benign
R7034:Btaf1	UTSW	19	37004469	missense	probably benign
R7036:Btaf1	UTSW	19	37004469	missense	probably benign
R7085:Btaf1	UTSW	19	36972918	missense	probably benign
R7097:Btaf1	UTSW	19	36949102	missense	probably damaging	1.00
R7248:Btaf1	UTSW	19	36945314	missense	possibly damaging	0.54
R7386:Btaf1	UTSW	19	36958382	missense	probably benign	0.02
R7402:Btaf1	UTSW	19	37003515	missense	probably damaging	1.00
R7452:Btaf1	UTSW	19	36969127	missense	probably damaging	1.00
R7493:Btaf1	UTSW	19	37009605	missense	probably damaging	1.00
R7513:Btaf1	UTSW	19	36978403	missense	probably benign	0.30
R7888:Btaf1	UTSW	19	36965636	missense	probably benign	0.10
R7944:Btaf1	UTSW	19	36949165	missense	probably benign
R8062:Btaf1	UTSW	19	36992465	missense	probably benign	0.00
R8559:Btaf1	UTSW	19	36986873	missense	probably benign	0.00
R8793:Btaf1	UTSW	19	36981029	missense	probably benign	0.21
R8855:Btaf1	UTSW	19	36958501	missense	probably benign
R8866:Btaf1	UTSW	19	36958501	missense	probably benign
R9016:Btaf1	UTSW	19	36994305	missense	probably benign	0.00
R9028:Btaf1	UTSW	19	36969108	missense	probably damaging	1.00
R9109:Btaf1	UTSW	19	36986714	missense	probably benign
R9172:Btaf1	UTSW	19	37000230	missense	probably damaging	0.98
R9298:Btaf1	UTSW	19	36986714	missense	probably benign
R9717:Btaf1	UTSW	19	36945246	missense	probably benign	0.28
W0251:Btaf1	UTSW	19	37003504	missense	probably damaging	1.00
X0027:Btaf1	UTSW	19	36949096	nonsense	probably null
Z1088:Btaf1	UTSW	19	36986618	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GAGTGCCACTCTGCCTGTCT -3'
(R):5'- ACGAGTAGATGTAAGCACAGC -3'

Sequencing Primer
(F):5'- CTCAACTGTGTAGCCTAGACTGG -3'
(R):5'- GTAAGCACAGCATTTTTCTTGTGC -3'

Posted On

2016-02-04