Incidental Mutation 'R4797:Cdh17'
ID369121
Institutional Source Beutler Lab
Gene Symbol Cdh17
Ensembl Gene ENSMUSG00000028217
Gene Namecadherin 17
SynonymsBILL-cadherin, LI-cadherin, HPT-1
MMRRC Submission 042421-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R4797 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location11758147-11817895 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 11810390 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 694 (Q694K)
Ref Sequence ENSEMBL: ENSMUSP00000103938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029871] [ENSMUST00000108303]
Predicted Effect probably benign
Transcript: ENSMUST00000029871
AA Change: Q694K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000029871
Gene: ENSMUSG00000028217
AA Change: Q694K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CA 44 123 5.27e-10 SMART
CA 147 241 6.9e-14 SMART
CA 258 337 3.05e-15 SMART
CA 361 446 3.29e-11 SMART
CA 471 564 5.27e-10 SMART
CA 587 664 5.59e-23 SMART
Blast:CA 687 771 5e-39 BLAST
transmembrane domain 784 806 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108303
AA Change: Q694K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000103938
Gene: ENSMUSG00000028217
AA Change: Q694K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CA 44 123 5.27e-10 SMART
CA 147 241 6.9e-14 SMART
CA 258 337 3.05e-15 SMART
CA 361 446 3.29e-11 SMART
CA 471 564 5.27e-10 SMART
CA 587 664 5.59e-23 SMART
Meta Mutation Damage Score 0.1062 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 96% (69/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily, genes encoding calcium-dependent, membrane-associated glycoproteins. The encoded protein is cadherin-like, consisting of an extracellular region, containing 7 cadherin domains, and a transmembrane region but lacking the conserved cytoplasmic domain. The protein is a component of the gastrointestinal tract and pancreatic ducts, acting as an intestinal proton-dependent peptide transporter in the first step in oral absorption of many medically important peptide-based drugs. The protein may also play a role in the morphological organization of liver and intestine. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2009]
PHENOTYPE: Homozygous mutant mice exhibit impaired B lymphocyte development and impaired IgG1 and IgG3 antibody response to T-independent antigen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T C 11: 110,118,119 T1195A probably benign Het
Apobr G A 7: 126,587,584 E756K probably benign Het
Arpc3 A G 5: 122,404,152 E77G possibly damaging Het
Atp2b2 A T 6: 113,789,886 M464K possibly damaging Het
Atxn7l2 A G 3: 108,204,550 S379P probably damaging Het
Ccdc91 A T 6: 147,592,143 E344D unknown Het
Cdc42bpg G A 19: 6,320,447 R1190Q probably damaging Het
Chordc1 G T 9: 18,292,376 probably benign Het
Copg1 A G 6: 87,903,468 probably benign Het
Dcbld1 T C 10: 52,284,127 V37A probably damaging Het
Ddb2 A G 2: 91,236,818 probably benign Het
Dok5 A T 2: 170,830,122 R115* probably null Het
Drc7 T C 8: 95,074,297 I649T probably damaging Het
E130309D02Rik A G 5: 143,311,749 F181S probably benign Het
Efr3a A G 15: 65,857,588 T713A probably damaging Het
Epg5 G A 18: 78,030,399 D2494N probably benign Het
Eps15 G A 4: 109,366,530 probably benign Het
Glb1l3 T C 9: 26,828,446 D356G probably damaging Het
Gm10639 A T 9: 78,304,397 Y147F probably benign Het
Gm1818 A T 12: 48,555,610 noncoding transcript Het
Gm4450 T A 3: 98,456,431 R62* probably null Het
Hcrtr2 C A 9: 76,254,534 M191I probably damaging Het
Heatr1 G A 13: 12,412,048 E685K probably benign Het
Hsd3b2 A T 3: 98,711,663 L322Q probably damaging Het
Htra4 T C 8: 25,033,659 T297A probably damaging Het
Il22 C A 10: 118,205,153 R55S probably damaging Het
Ints1 G A 5: 139,771,876 T324M possibly damaging Het
Ints7 T C 1: 191,596,933 V268A probably damaging Het
Kctd20 G A 17: 28,966,792 V370I probably damaging Het
Lama1 T A 17: 67,716,775 M55K probably benign Het
Larp1 C A 11: 58,047,980 S494* probably null Het
Ldb3 A T 14: 34,555,513 H262Q possibly damaging Het
Lepr C A 4: 101,780,047 T711K possibly damaging Het
Mon2 T C 10: 123,016,517 I984V probably benign Het
Naip2 T A 13: 100,161,735 S598C probably damaging Het
Oasl1 A G 5: 114,928,158 M112V probably benign Het
Olfr371 G T 8: 85,230,938 A148S probably benign Het
Olfr715b A T 7: 107,106,027 M278K probably benign Het
Olfr807 A T 10: 129,754,521 S310T probably benign Het
P2ry1 T A 3: 61,003,460 S7T probably benign Het
Pidd1 G T 7: 141,442,986 R98S possibly damaging Het
Pkd1l1 A C 11: 8,961,340 F312L unknown Het
Pla2r1 A T 2: 60,504,180 M416K possibly damaging Het
Pold1 T C 7: 44,541,901 E194G possibly damaging Het
Poldip2 T A 11: 78,513,987 Y77N probably damaging Het
Ppp2r3a G T 9: 101,211,980 N381K probably benign Het
Prrc2a G A 17: 35,150,042 P2006L probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rsu1 A G 2: 13,216,726 probably benign Het
Selenoi T A 5: 30,252,742 W90R probably damaging Het
Spag17 T A 3: 99,984,479 D216E possibly damaging Het
Spata31 C A 13: 64,922,742 Y901* probably null Het
Ssrp1 T A 2: 85,045,722 Y607* probably null Het
Stk10 T A 11: 32,598,471 N346K probably benign Het
Surf1 G T 2: 26,916,346 probably benign Het
Synj2 A T 17: 6,033,888 E283V probably damaging Het
Tg G A 15: 66,758,006 probably null Het
Traf1 A T 2: 34,956,277 D42E probably benign Het
Ttn T C 2: 76,740,865 I26561M probably damaging Het
Ubp1 T C 9: 113,956,002 Y128H probably damaging Het
Vmn1r216 T A 13: 23,099,336 I63K probably benign Het
Vmn1r49 T A 6: 90,072,630 H130L probably benign Het
Vmn2r90 C T 17: 17,712,305 T158I probably damaging Het
Vps13d T C 4: 145,054,155 S885G probably damaging Het
Other mutations in Cdh17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Cdh17 APN 4 11797780 splice site probably benign
IGL00823:Cdh17 APN 4 11783412 missense possibly damaging 0.78
IGL00824:Cdh17 APN 4 11784675 missense probably benign 0.00
IGL01572:Cdh17 APN 4 11784621 splice site probably benign
IGL01602:Cdh17 APN 4 11795670 missense probably damaging 1.00
IGL01605:Cdh17 APN 4 11795670 missense probably damaging 1.00
IGL01759:Cdh17 APN 4 11771262 splice site probably benign
IGL02065:Cdh17 APN 4 11771373 splice site probably benign
IGL02448:Cdh17 APN 4 11784680 missense probably benign
IGL02869:Cdh17 APN 4 11814908 missense probably benign 0.00
IGL03088:Cdh17 APN 4 11810473 missense probably damaging 1.00
Disruptive UTSW 4 11784654 missense probably damaging 1.00
R0054:Cdh17 UTSW 4 11785186 missense possibly damaging 0.59
R0081:Cdh17 UTSW 4 11785280 splice site probably benign
R0101:Cdh17 UTSW 4 11771341 missense probably benign 0.00
R0432:Cdh17 UTSW 4 11771273 nonsense probably null
R0718:Cdh17 UTSW 4 11810451 missense possibly damaging 0.68
R0946:Cdh17 UTSW 4 11795581 missense probably benign 0.01
R1076:Cdh17 UTSW 4 11795581 missense probably benign 0.01
R1217:Cdh17 UTSW 4 11799676 missense probably benign 0.04
R2060:Cdh17 UTSW 4 11803982 missense probably benign 0.03
R3808:Cdh17 UTSW 4 11795671 missense probably damaging 0.99
R3850:Cdh17 UTSW 4 11785201 missense probably damaging 1.00
R4111:Cdh17 UTSW 4 11814628 missense probably damaging 0.99
R4112:Cdh17 UTSW 4 11814628 missense probably damaging 0.99
R4583:Cdh17 UTSW 4 11810466 missense probably benign 0.00
R4683:Cdh17 UTSW 4 11817036 missense possibly damaging 0.78
R5050:Cdh17 UTSW 4 11784654 missense probably damaging 1.00
R5071:Cdh17 UTSW 4 11810325 missense probably damaging 0.98
R5569:Cdh17 UTSW 4 11816990 missense probably damaging 0.96
R5790:Cdh17 UTSW 4 11814945 unclassified probably null
R6077:Cdh17 UTSW 4 11803969 missense probably benign 0.22
R6581:Cdh17 UTSW 4 11799615 missense probably damaging 1.00
R7274:Cdh17 UTSW 4 11783174 nonsense probably null
R7647:Cdh17 UTSW 4 11814698 missense probably damaging 1.00
R7649:Cdh17 UTSW 4 11814698 missense probably damaging 1.00
X0067:Cdh17 UTSW 4 11785224 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCACCCTTCAATTTCTTAGGTGGG -3'
(R):5'- TTATACTGAACAGGTGTCAGGG -3'

Sequencing Primer
(F):5'- GTCCTCTCTGAGTTCTACGGCAG -3'
(R):5'- GGGGCACTCCTGGTTTATTCC -3'
Posted On2016-02-04