Incidental Mutation 'R4797:Dcbld1'
ID369147
Institutional Source Beutler Lab
Gene Symbol Dcbld1
Ensembl Gene ENSMUSG00000019891
Gene Namediscoidin, CUB and LCCL domain containing 1
Synonyms4631413K11Rik
MMRRC Submission 042421-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4797 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location52233619-52321378 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 52284127 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 37 (V37A)
Ref Sequence ENSEMBL: ENSMUSP00000151265 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069004] [ENSMUST00000218582]
Predicted Effect probably benign
Transcript: ENSMUST00000069004
AA Change: V108A

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000068203
Gene: ENSMUSG00000019891
AA Change: V108A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
CUB 32 141 6.42e-23 SMART
Pfam:LCCL 147 239 4.5e-19 PFAM
transmembrane domain 248 270 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000101116
Gene: ENSMUSG00000019891
AA Change: V37A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
SCOP:d1sfp__ 28 69 3e-6 SMART
Pfam:LCCL 76 168 3.6e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140921
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218278
Predicted Effect probably damaging
Transcript: ENSMUST00000218582
AA Change: V37A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Meta Mutation Damage Score 0.1765 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 96% (69/72)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T C 11: 110,118,119 T1195A probably benign Het
Apobr G A 7: 126,587,584 E756K probably benign Het
Arpc3 A G 5: 122,404,152 E77G possibly damaging Het
Atp2b2 A T 6: 113,789,886 M464K possibly damaging Het
Atxn7l2 A G 3: 108,204,550 S379P probably damaging Het
Ccdc91 A T 6: 147,592,143 E344D unknown Het
Cdc42bpg G A 19: 6,320,447 R1190Q probably damaging Het
Cdh17 C A 4: 11,810,390 Q694K probably benign Het
Chordc1 G T 9: 18,292,376 probably benign Het
Copg1 A G 6: 87,903,468 probably benign Het
Ddb2 A G 2: 91,236,818 probably benign Het
Dok5 A T 2: 170,830,122 R115* probably null Het
Drc7 T C 8: 95,074,297 I649T probably damaging Het
E130309D02Rik A G 5: 143,311,749 F181S probably benign Het
Efr3a A G 15: 65,857,588 T713A probably damaging Het
Epg5 G A 18: 78,030,399 D2494N probably benign Het
Eps15 G A 4: 109,366,530 probably benign Het
Glb1l3 T C 9: 26,828,446 D356G probably damaging Het
Gm10639 A T 9: 78,304,397 Y147F probably benign Het
Gm1818 A T 12: 48,555,610 noncoding transcript Het
Gm4450 T A 3: 98,456,431 R62* probably null Het
Hcrtr2 C A 9: 76,254,534 M191I probably damaging Het
Heatr1 G A 13: 12,412,048 E685K probably benign Het
Hsd3b2 A T 3: 98,711,663 L322Q probably damaging Het
Htra4 T C 8: 25,033,659 T297A probably damaging Het
Il22 C A 10: 118,205,153 R55S probably damaging Het
Ints1 G A 5: 139,771,876 T324M possibly damaging Het
Ints7 T C 1: 191,596,933 V268A probably damaging Het
Kctd20 G A 17: 28,966,792 V370I probably damaging Het
Lama1 T A 17: 67,716,775 M55K probably benign Het
Larp1 C A 11: 58,047,980 S494* probably null Het
Ldb3 A T 14: 34,555,513 H262Q possibly damaging Het
Lepr C A 4: 101,780,047 T711K possibly damaging Het
Mon2 T C 10: 123,016,517 I984V probably benign Het
Naip2 T A 13: 100,161,735 S598C probably damaging Het
Oasl1 A G 5: 114,928,158 M112V probably benign Het
Olfr371 G T 8: 85,230,938 A148S probably benign Het
Olfr715b A T 7: 107,106,027 M278K probably benign Het
Olfr807 A T 10: 129,754,521 S310T probably benign Het
P2ry1 T A 3: 61,003,460 S7T probably benign Het
Pidd1 G T 7: 141,442,986 R98S possibly damaging Het
Pkd1l1 A C 11: 8,961,340 F312L unknown Het
Pla2r1 A T 2: 60,504,180 M416K possibly damaging Het
Pold1 T C 7: 44,541,901 E194G possibly damaging Het
Poldip2 T A 11: 78,513,987 Y77N probably damaging Het
Ppp2r3a G T 9: 101,211,980 N381K probably benign Het
Prrc2a G A 17: 35,150,042 P2006L probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rsu1 A G 2: 13,216,726 probably benign Het
Selenoi T A 5: 30,252,742 W90R probably damaging Het
Spag17 T A 3: 99,984,479 D216E possibly damaging Het
Spata31 C A 13: 64,922,742 Y901* probably null Het
Ssrp1 T A 2: 85,045,722 Y607* probably null Het
Stk10 T A 11: 32,598,471 N346K probably benign Het
Surf1 G T 2: 26,916,346 probably benign Het
Synj2 A T 17: 6,033,888 E283V probably damaging Het
Tg G A 15: 66,758,006 probably null Het
Traf1 A T 2: 34,956,277 D42E probably benign Het
Ttn T C 2: 76,740,865 I26561M probably damaging Het
Ubp1 T C 9: 113,956,002 Y128H probably damaging Het
Vmn1r216 T A 13: 23,099,336 I63K probably benign Het
Vmn1r49 T A 6: 90,072,630 H130L probably benign Het
Vmn2r90 C T 17: 17,712,305 T158I probably damaging Het
Vps13d T C 4: 145,054,155 S885G probably damaging Het
Other mutations in Dcbld1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00654:Dcbld1 APN 10 52312849 missense probably benign
IGL01974:Dcbld1 APN 10 52304681 missense probably benign 0.00
IGL01997:Dcbld1 APN 10 52317110 missense probably damaging 0.98
IGL02811:Dcbld1 APN 10 52319973 missense probably benign
IGL03011:Dcbld1 APN 10 52284148 missense probably damaging 0.98
IGL03329:Dcbld1 APN 10 52319625 missense probably damaging 0.99
IGL03048:Dcbld1 UTSW 10 52304626 missense probably damaging 1.00
R0392:Dcbld1 UTSW 10 52317134 missense possibly damaging 0.92
R0532:Dcbld1 UTSW 10 52317077 missense probably benign 0.06
R0561:Dcbld1 UTSW 10 52261936 missense probably benign 0.02
R0625:Dcbld1 UTSW 10 52312850 missense probably benign 0.38
R0907:Dcbld1 UTSW 10 52261814 missense possibly damaging 0.83
R1567:Dcbld1 UTSW 10 52319656 missense probably damaging 1.00
R1791:Dcbld1 UTSW 10 52319476 missense probably damaging 0.99
R1915:Dcbld1 UTSW 10 52317035 missense probably damaging 0.98
R1921:Dcbld1 UTSW 10 52319651 missense possibly damaging 0.94
R2119:Dcbld1 UTSW 10 52319979 missense probably benign
R2163:Dcbld1 UTSW 10 52286356 missense probably damaging 1.00
R2520:Dcbld1 UTSW 10 52319545 missense probably damaging 0.99
R3196:Dcbld1 UTSW 10 52319491 missense probably damaging 0.99
R3788:Dcbld1 UTSW 10 52319658 missense probably damaging 1.00
R4904:Dcbld1 UTSW 10 52319970 nonsense probably null
R5177:Dcbld1 UTSW 10 52304634 missense probably damaging 1.00
R5329:Dcbld1 UTSW 10 52284257 intron probably benign
R5456:Dcbld1 UTSW 10 52314390 missense probably damaging 1.00
R6151:Dcbld1 UTSW 10 52304660 missense probably damaging 1.00
R6267:Dcbld1 UTSW 10 52319480 nonsense probably null
R6421:Dcbld1 UTSW 10 52286354 missense probably damaging 1.00
R7031:Dcbld1 UTSW 10 52290889 missense probably damaging 1.00
R7738:Dcbld1 UTSW 10 52312826 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- ACTTCTAAACTATTGCTTGTCTGGG -3'
(R):5'- TCACAATTATGCCCAGAGGAAG -3'

Sequencing Primer
(F):5'- AGGCTTAGCTGTCCAATCAG -3'
(R):5'- CAATTATGCCCAGAGGAAGAGATAAG -3'
Posted On2016-02-04