Incidental Mutation 'R4797:Heatr1'
ID369158
Institutional Source Beutler Lab
Gene Symbol Heatr1
Ensembl Gene ENSMUSG00000050244
Gene NameHEAT repeat containing 1
SynonymsB130016L12Rik
MMRRC Submission 042421-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R4797 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location12395027-12440289 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 12412048 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 685 (E685K)
Ref Sequence ENSEMBL: ENSMUSP00000054084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059270]
Predicted Effect probably benign
Transcript: ENSMUST00000059270
AA Change: E685K

PolyPhen 2 Score 0.363 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000054084
Gene: ENSMUSG00000050244
AA Change: E685K

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
Pfam:U3snoRNP10 238 354 7e-30 PFAM
SCOP:d1qbkb_ 919 1795 3e-8 SMART
low complexity region 1805 1814 N/A INTRINSIC
BP28CT 1856 2009 2.25e-77 SMART
Blast:BP28CT 2015 2061 2e-15 BLAST
coiled coil region 2109 2137 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221746
Meta Mutation Damage Score 0.1492 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 96% (69/72)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T C 11: 110,118,119 T1195A probably benign Het
Apobr G A 7: 126,587,584 E756K probably benign Het
Arpc3 A G 5: 122,404,152 E77G possibly damaging Het
Atp2b2 A T 6: 113,789,886 M464K possibly damaging Het
Atxn7l2 A G 3: 108,204,550 S379P probably damaging Het
Ccdc91 A T 6: 147,592,143 E344D unknown Het
Cdc42bpg G A 19: 6,320,447 R1190Q probably damaging Het
Cdh17 C A 4: 11,810,390 Q694K probably benign Het
Chordc1 G T 9: 18,292,376 probably benign Het
Copg1 A G 6: 87,903,468 probably benign Het
Dcbld1 T C 10: 52,284,127 V37A probably damaging Het
Ddb2 A G 2: 91,236,818 probably benign Het
Dok5 A T 2: 170,830,122 R115* probably null Het
Drc7 T C 8: 95,074,297 I649T probably damaging Het
E130309D02Rik A G 5: 143,311,749 F181S probably benign Het
Efr3a A G 15: 65,857,588 T713A probably damaging Het
Epg5 G A 18: 78,030,399 D2494N probably benign Het
Eps15 G A 4: 109,366,530 probably benign Het
Glb1l3 T C 9: 26,828,446 D356G probably damaging Het
Gm10639 A T 9: 78,304,397 Y147F probably benign Het
Gm1818 A T 12: 48,555,610 noncoding transcript Het
Gm4450 T A 3: 98,456,431 R62* probably null Het
Hcrtr2 C A 9: 76,254,534 M191I probably damaging Het
Hsd3b2 A T 3: 98,711,663 L322Q probably damaging Het
Htra4 T C 8: 25,033,659 T297A probably damaging Het
Il22 C A 10: 118,205,153 R55S probably damaging Het
Ints1 G A 5: 139,771,876 T324M possibly damaging Het
Ints7 T C 1: 191,596,933 V268A probably damaging Het
Kctd20 G A 17: 28,966,792 V370I probably damaging Het
Lama1 T A 17: 67,716,775 M55K probably benign Het
Larp1 C A 11: 58,047,980 S494* probably null Het
Ldb3 A T 14: 34,555,513 H262Q possibly damaging Het
Lepr C A 4: 101,780,047 T711K possibly damaging Het
Mon2 T C 10: 123,016,517 I984V probably benign Het
Naip2 T A 13: 100,161,735 S598C probably damaging Het
Oasl1 A G 5: 114,928,158 M112V probably benign Het
Olfr371 G T 8: 85,230,938 A148S probably benign Het
Olfr715b A T 7: 107,106,027 M278K probably benign Het
Olfr807 A T 10: 129,754,521 S310T probably benign Het
P2ry1 T A 3: 61,003,460 S7T probably benign Het
Pidd1 G T 7: 141,442,986 R98S possibly damaging Het
Pkd1l1 A C 11: 8,961,340 F312L unknown Het
Pla2r1 A T 2: 60,504,180 M416K possibly damaging Het
Pold1 T C 7: 44,541,901 E194G possibly damaging Het
Poldip2 T A 11: 78,513,987 Y77N probably damaging Het
Ppp2r3a G T 9: 101,211,980 N381K probably benign Het
Prrc2a G A 17: 35,150,042 P2006L probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rsu1 A G 2: 13,216,726 probably benign Het
Selenoi T A 5: 30,252,742 W90R probably damaging Het
Spag17 T A 3: 99,984,479 D216E possibly damaging Het
Spata31 C A 13: 64,922,742 Y901* probably null Het
Ssrp1 T A 2: 85,045,722 Y607* probably null Het
Stk10 T A 11: 32,598,471 N346K probably benign Het
Surf1 G T 2: 26,916,346 probably benign Het
Synj2 A T 17: 6,033,888 E283V probably damaging Het
Tg G A 15: 66,758,006 probably null Het
Traf1 A T 2: 34,956,277 D42E probably benign Het
Ttn T C 2: 76,740,865 I26561M probably damaging Het
Ubp1 T C 9: 113,956,002 Y128H probably damaging Het
Vmn1r216 T A 13: 23,099,336 I63K probably benign Het
Vmn1r49 T A 6: 90,072,630 H130L probably benign Het
Vmn2r90 C T 17: 17,712,305 T158I probably damaging Het
Vps13d T C 4: 145,054,155 S885G probably damaging Het
Other mutations in Heatr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00666:Heatr1 APN 13 12410450 missense probably benign 0.00
IGL00863:Heatr1 APN 13 12435128 missense probably benign 0.02
IGL00899:Heatr1 APN 13 12435176 missense probably benign 0.31
IGL01147:Heatr1 APN 13 12437912 missense probably damaging 0.99
IGL01317:Heatr1 APN 13 12399027 missense probably damaging 1.00
IGL01323:Heatr1 APN 13 12398938 missense possibly damaging 0.86
IGL01625:Heatr1 APN 13 12413528 missense probably damaging 0.98
IGL01973:Heatr1 APN 13 12429799 missense probably benign
IGL02803:Heatr1 APN 13 12433986 missense probably damaging 0.96
IGL02830:Heatr1 APN 13 12426212 missense possibly damaging 0.57
IGL02956:Heatr1 APN 13 12416059 missense possibly damaging 0.53
IGL03000:Heatr1 APN 13 12434411 missense probably damaging 0.99
IGL03024:Heatr1 APN 13 12407509 unclassified probably benign
IGL03035:Heatr1 APN 13 12413219 splice site probably benign
IGL03301:Heatr1 APN 13 12434205 missense probably damaging 1.00
hasan UTSW 13 12417447 splice site probably benign
H8562:Heatr1 UTSW 13 12408713 missense probably benign 0.13
R0226:Heatr1 UTSW 13 12410562 missense probably damaging 1.00
R0571:Heatr1 UTSW 13 12430240 missense probably damaging 0.98
R0722:Heatr1 UTSW 13 12406037 missense probably benign 0.14
R1264:Heatr1 UTSW 13 12424610 unclassified probably benign
R1371:Heatr1 UTSW 13 12417632 missense possibly damaging 0.80
R1388:Heatr1 UTSW 13 12417447 splice site probably benign
R1396:Heatr1 UTSW 13 12406046 missense possibly damaging 0.86
R1519:Heatr1 UTSW 13 12412159 missense probably benign
R1689:Heatr1 UTSW 13 12424625 missense probably benign 0.00
R1696:Heatr1 UTSW 13 12423721 missense possibly damaging 0.96
R1756:Heatr1 UTSW 13 12396460 missense probably benign 0.01
R1859:Heatr1 UTSW 13 12403159 missense probably damaging 1.00
R1932:Heatr1 UTSW 13 12435185 missense probably damaging 1.00
R1957:Heatr1 UTSW 13 12396538 missense probably damaging 1.00
R2018:Heatr1 UTSW 13 12414478 missense possibly damaging 0.68
R2106:Heatr1 UTSW 13 12412058 missense probably benign 0.03
R2119:Heatr1 UTSW 13 12432646 missense probably null 1.00
R2121:Heatr1 UTSW 13 12403264 missense probably benign 0.10
R2122:Heatr1 UTSW 13 12403264 missense probably benign 0.10
R2367:Heatr1 UTSW 13 12433724 missense probably damaging 1.00
R3777:Heatr1 UTSW 13 12413348 missense possibly damaging 0.92
R3783:Heatr1 UTSW 13 12434460 missense probably damaging 1.00
R3784:Heatr1 UTSW 13 12434460 missense probably damaging 1.00
R3786:Heatr1 UTSW 13 12434460 missense probably damaging 1.00
R3787:Heatr1 UTSW 13 12434460 missense probably damaging 1.00
R3843:Heatr1 UTSW 13 12435121 missense probably benign 0.00
R4533:Heatr1 UTSW 13 12434511 missense probably benign 0.05
R4725:Heatr1 UTSW 13 12424662 nonsense probably null
R4763:Heatr1 UTSW 13 12430930 missense possibly damaging 0.65
R4793:Heatr1 UTSW 13 12431837 missense probably benign 0.00
R4798:Heatr1 UTSW 13 12412048 missense probably benign 0.36
R4942:Heatr1 UTSW 13 12413510 critical splice acceptor site probably null
R4952:Heatr1 UTSW 13 12410599 missense probably benign 0.38
R4954:Heatr1 UTSW 13 12407516 critical splice acceptor site probably null
R5370:Heatr1 UTSW 13 12401522 missense probably benign 0.02
R5464:Heatr1 UTSW 13 12433643 missense probably benign 0.00
R5483:Heatr1 UTSW 13 12398914 missense probably damaging 1.00
R5497:Heatr1 UTSW 13 12421064 missense possibly damaging 0.93
R5504:Heatr1 UTSW 13 12406619 missense possibly damaging 0.64
R5527:Heatr1 UTSW 13 12402760 missense probably damaging 1.00
R5527:Heatr1 UTSW 13 12404948 missense probably benign
R5836:Heatr1 UTSW 13 12408736 missense probably damaging 0.99
R5916:Heatr1 UTSW 13 12434471 missense probably damaging 1.00
R6018:Heatr1 UTSW 13 12404947 missense probably benign
R6018:Heatr1 UTSW 13 12406058 missense probably benign 0.26
R6216:Heatr1 UTSW 13 12432664 missense probably benign 0.16
R6396:Heatr1 UTSW 13 12406097 missense possibly damaging 0.86
R6472:Heatr1 UTSW 13 12434230 missense probably benign 0.29
R6922:Heatr1 UTSW 13 12435075 missense probably benign 0.00
R7077:Heatr1 UTSW 13 12418164 missense possibly damaging 0.63
R7297:Heatr1 UTSW 13 12421060 nonsense probably null
R7445:Heatr1 UTSW 13 12431038 missense possibly damaging 0.70
R7669:Heatr1 UTSW 13 12411262 missense probably benign 0.33
R7672:Heatr1 UTSW 13 12438664 missense probably damaging 0.96
R7772:Heatr1 UTSW 13 12417641 missense probably benign 0.03
R8205:Heatr1 UTSW 13 12416047 missense probably benign
RF011:Heatr1 UTSW 13 12407544 missense probably benign 0.00
Z1176:Heatr1 UTSW 13 12399008 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- GGTCTGTGGGTTAAATGCATAAAC -3'
(R):5'- GTGTTATTTTACCCAACACCCAAC -3'

Sequencing Primer
(F):5'- CTGTGGGTTAAATGCATAAACTTGTC -3'
(R):5'- ACAGCAGTGATGACGCTTTTGAG -3'
Posted On2016-02-04