Incidental Mutation 'R4797:Tg'
ID 369164
Institutional Source Beutler Lab
Gene Symbol Tg
Ensembl Gene ENSMUSG00000053469
Gene Name thyroglobulin
Synonyms Tgn
MMRRC Submission 042421-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.096) question?
Stock # R4797 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 66542606-66722570 bp(+) (GRCm39)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 66629855 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000126454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065916] [ENSMUST00000163495] [ENSMUST00000171045] [ENSMUST00000171045]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000065916
SMART Domains Protein: ENSMUSP00000070239
Gene: ENSMUSG00000053469

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
TY 50 97 5.9e-16 SMART
TY 118 165 5.59e-17 SMART
Pfam:Thyroglobulin_1 174 252 4e-9 PFAM
TY 317 363 4.36e-19 SMART
low complexity region 495 504 N/A INTRINSIC
TY 617 662 3.58e-15 SMART
TY 684 730 1.47e-16 SMART
TY 880 926 1.51e-4 SMART
TY 1029 1078 1.21e-12 SMART
TY 1106 1150 7.56e-5 SMART
TY 1167 1215 7.26e-16 SMART
low complexity region 1244 1255 N/A INTRINSIC
Pfam:GCC2_GCC3 1464 1509 2.7e-16 PFAM
TY 1519 1568 9.81e-13 SMART
Pfam:COesterase 2181 2717 8.4e-140 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163495
SMART Domains Protein: ENSMUSP00000129868
Gene: ENSMUSG00000053469

DomainStartEndE-ValueType
TY 14 63 1.21e-12 SMART
Predicted Effect probably null
Transcript: ENSMUST00000171045
SMART Domains Protein: ENSMUSP00000126454
Gene: ENSMUSG00000053469

DomainStartEndE-ValueType
internal_repeat_1 93 331 1.53e-6 PROSPERO
Pfam:COesterase 562 1098 2.1e-137 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000171045
SMART Domains Protein: ENSMUSP00000126454
Gene: ENSMUSG00000053469

DomainStartEndE-ValueType
internal_repeat_1 93 331 1.53e-6 PROSPERO
Pfam:COesterase 562 1098 2.1e-137 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172153
SMART Domains Protein: ENSMUSP00000128410
Gene: ENSMUSG00000053469

DomainStartEndE-ValueType
Pfam:COesterase 313 849 6e-140 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172153
SMART Domains Protein: ENSMUSP00000128410
Gene: ENSMUSG00000053469

DomainStartEndE-ValueType
Pfam:COesterase 313 849 6e-140 PFAM
Meta Mutation Damage Score 0.9469 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 96% (69/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Thyroglobulin (Tg) is a glycoprotein homodimer produced predominantly by the thryroid gland. It acts as a substrate for the synthesis of thyroxine and triiodothyronine as well as the storage of the inactive forms of thyroid hormone and iodine. Thyroglobulin is secreted from the endoplasmic reticulum to its site of iodination, and subsequent thyroxine biosynthesis, in the follicular lumen. Mutations in this gene cause thyroid dyshormonogenesis, manifested as goiter, and are associated with moderate to severe congenital hypothyroidism. Polymorphisms in this gene are associated with susceptibility to autoimmune thyroid diseases (AITD) such as Graves disease and Hashimoto thryoiditis. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit enlarged thyroid gland, hypothyroidism, abnormal thyroid gland morphology, and decreased body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T C 11: 110,008,945 (GRCm39) T1195A probably benign Het
Apobr G A 7: 126,186,756 (GRCm39) E756K probably benign Het
Arpc3 A G 5: 122,542,215 (GRCm39) E77G possibly damaging Het
Atp2b2 A T 6: 113,766,847 (GRCm39) M464K possibly damaging Het
Atxn7l2 A G 3: 108,111,866 (GRCm39) S379P probably damaging Het
Ccdc91 A T 6: 147,493,641 (GRCm39) E344D unknown Het
Cdc42bpg G A 19: 6,370,477 (GRCm39) R1190Q probably damaging Het
Cdh17 C A 4: 11,810,390 (GRCm39) Q694K probably benign Het
Chordc1 G T 9: 18,203,672 (GRCm39) probably benign Het
Copg1 A G 6: 87,880,450 (GRCm39) probably benign Het
Dcbld1 T C 10: 52,160,223 (GRCm39) V37A probably damaging Het
Ddb2 A G 2: 91,067,163 (GRCm39) probably benign Het
Dok5 A T 2: 170,672,042 (GRCm39) R115* probably null Het
Drc7 T C 8: 95,800,925 (GRCm39) I649T probably damaging Het
Efr3a A G 15: 65,729,437 (GRCm39) T713A probably damaging Het
Epg5 G A 18: 78,073,614 (GRCm39) D2494N probably benign Het
Eps15 G A 4: 109,223,727 (GRCm39) probably benign Het
Glb1l3 T C 9: 26,739,742 (GRCm39) D356G probably damaging Het
Gm1818 A T 12: 48,602,393 (GRCm39) noncoding transcript Het
Gsta5 A T 9: 78,211,679 (GRCm39) Y147F probably benign Het
Hcrtr2 C A 9: 76,161,816 (GRCm39) M191I probably damaging Het
Heatr1 G A 13: 12,426,929 (GRCm39) E685K probably benign Het
Hsd3b2 A T 3: 98,618,979 (GRCm39) L322Q probably damaging Het
Hsd3b9 T A 3: 98,363,747 (GRCm39) R62* probably null Het
Htra4 T C 8: 25,523,675 (GRCm39) T297A probably damaging Het
Il22 C A 10: 118,041,058 (GRCm39) R55S probably damaging Het
Ints1 G A 5: 139,757,631 (GRCm39) T324M possibly damaging Het
Ints15 A G 5: 143,297,504 (GRCm39) F181S probably benign Het
Ints7 T C 1: 191,329,045 (GRCm39) V268A probably damaging Het
Kctd20 G A 17: 29,185,766 (GRCm39) V370I probably damaging Het
Lama1 T A 17: 68,023,770 (GRCm39) M55K probably benign Het
Larp1 C A 11: 57,938,806 (GRCm39) S494* probably null Het
Ldb3 A T 14: 34,277,470 (GRCm39) H262Q possibly damaging Het
Lepr C A 4: 101,637,244 (GRCm39) T711K possibly damaging Het
Mon2 T C 10: 122,852,422 (GRCm39) I984V probably benign Het
Naip2 T A 13: 100,298,243 (GRCm39) S598C probably damaging Het
Oasl1 A G 5: 115,066,217 (GRCm39) M112V probably benign Het
Or2d2b A T 7: 106,705,234 (GRCm39) M278K probably benign Het
Or6c214 A T 10: 129,590,390 (GRCm39) S310T probably benign Het
Or7c19 G T 8: 85,957,567 (GRCm39) A148S probably benign Het
P2ry1 T A 3: 60,910,881 (GRCm39) S7T probably benign Het
Pidd1 G T 7: 141,022,899 (GRCm39) R98S possibly damaging Het
Pkd1l1 A C 11: 8,911,340 (GRCm39) F312L unknown Het
Pla2r1 A T 2: 60,334,524 (GRCm39) M416K possibly damaging Het
Pold1 T C 7: 44,191,325 (GRCm39) E194G possibly damaging Het
Poldip2 T A 11: 78,404,813 (GRCm39) Y77N probably damaging Het
Ppp2r3d G T 9: 101,089,179 (GRCm39) N381K probably benign Het
Prrc2a G A 17: 35,369,018 (GRCm39) P2006L probably damaging Het
Rnd2 C T 11: 101,359,825 (GRCm39) L57F probably damaging Het
Rsu1 A G 2: 13,221,537 (GRCm39) probably benign Het
Selenoi T A 5: 30,457,740 (GRCm39) W90R probably damaging Het
Spag17 T A 3: 99,891,795 (GRCm39) D216E possibly damaging Het
Spata31 C A 13: 65,070,556 (GRCm39) Y901* probably null Het
Ssrp1 T A 2: 84,876,066 (GRCm39) Y607* probably null Het
Stk10 T A 11: 32,548,471 (GRCm39) N346K probably benign Het
Surf1 G T 2: 26,806,358 (GRCm39) probably benign Het
Synj2 A T 17: 6,084,163 (GRCm39) E283V probably damaging Het
Traf1 A T 2: 34,846,289 (GRCm39) D42E probably benign Het
Ttn T C 2: 76,571,209 (GRCm39) I26561M probably damaging Het
Ubp1 T C 9: 113,785,070 (GRCm39) Y128H probably damaging Het
Vmn1r216 T A 13: 23,283,506 (GRCm39) I63K probably benign Het
Vmn1r49 T A 6: 90,049,612 (GRCm39) H130L probably benign Het
Vmn2r90 C T 17: 17,932,567 (GRCm39) T158I probably damaging Het
Vps13d T C 4: 144,780,725 (GRCm39) S885G probably damaging Het
Other mutations in Tg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Tg APN 15 66,719,015 (GRCm39) missense probably damaging 1.00
IGL00230:Tg APN 15 66,699,139 (GRCm39) missense probably benign 0.00
IGL00324:Tg APN 15 66,565,273 (GRCm39) missense probably benign
IGL00428:Tg APN 15 66,645,273 (GRCm39) missense probably benign 0.33
IGL00703:Tg APN 15 66,568,338 (GRCm39) missense probably benign 0.34
IGL00808:Tg APN 15 66,555,662 (GRCm39) missense probably damaging 1.00
IGL00833:Tg APN 15 66,560,650 (GRCm39) missense probably benign 0.34
IGL00899:Tg APN 15 66,545,922 (GRCm39) critical splice donor site probably null
IGL00921:Tg APN 15 66,636,302 (GRCm39) missense probably benign 0.28
IGL00975:Tg APN 15 66,553,731 (GRCm39) missense probably benign
IGL01288:Tg APN 15 66,608,125 (GRCm39) missense possibly damaging 0.81
IGL01397:Tg APN 15 66,567,941 (GRCm39) splice site probably benign
IGL01634:Tg APN 15 66,601,415 (GRCm39) missense probably benign 0.34
IGL01646:Tg APN 15 66,549,936 (GRCm39) missense probably damaging 1.00
IGL01704:Tg APN 15 66,543,200 (GRCm39) missense probably damaging 0.98
IGL01958:Tg APN 15 66,631,335 (GRCm39) missense probably benign 0.06
IGL02093:Tg APN 15 66,564,223 (GRCm39) missense possibly damaging 0.83
IGL02113:Tg APN 15 66,577,179 (GRCm39) missense probably benign 0.08
IGL02138:Tg APN 15 66,589,082 (GRCm39) missense probably benign 0.01
IGL02156:Tg APN 15 66,577,197 (GRCm39) missense probably benign 0.19
IGL02169:Tg APN 15 66,629,792 (GRCm39) missense probably benign 0.04
IGL02342:Tg APN 15 66,636,140 (GRCm39) missense probably benign
IGL02434:Tg APN 15 66,636,191 (GRCm39) missense probably damaging 0.97
IGL02506:Tg APN 15 66,613,443 (GRCm39) missense possibly damaging 0.71
IGL02513:Tg APN 15 66,577,123 (GRCm39) missense probably benign
IGL02549:Tg APN 15 66,711,210 (GRCm39) missense probably damaging 1.00
IGL02669:Tg APN 15 66,620,575 (GRCm39) splice site probably benign
IGL02756:Tg APN 15 66,606,435 (GRCm39) missense probably benign
IGL02800:Tg APN 15 66,629,735 (GRCm39) missense probably damaging 1.00
IGL02828:Tg APN 15 66,554,243 (GRCm39) missense probably damaging 1.00
IGL02927:Tg APN 15 66,549,942 (GRCm39) missense probably damaging 1.00
IGL03061:Tg APN 15 66,543,254 (GRCm39) missense probably damaging 1.00
IGL03105:Tg APN 15 66,586,955 (GRCm39) missense probably benign 0.01
IGL03160:Tg APN 15 66,711,152 (GRCm39) nonsense probably null
IGL03242:Tg APN 15 66,555,647 (GRCm39) missense probably damaging 0.99
Also_ran UTSW 15 66,550,688 (GRCm39) missense probably damaging 1.00
bedraggled UTSW 15 66,612,563 (GRCm39) missense probably damaging 1.00
foster UTSW 15 66,565,109 (GRCm39) nonsense probably null
hognose UTSW 15 66,589,057 (GRCm39) missense probably damaging 0.99
ito UTSW 15 66,638,011 (GRCm39) nonsense probably null
ito2 UTSW 15 66,543,245 (GRCm39) missense probably damaging 1.00
ito3 UTSW 15 66,645,323 (GRCm39) missense probably damaging 1.00
ito4 UTSW 15 66,568,369 (GRCm39) missense possibly damaging 0.47
Papua UTSW 15 66,545,899 (GRCm39) missense probably damaging 1.00
Pipistrella UTSW 15 66,567,984 (GRCm39) missense probably damaging 1.00
pluribus UTSW 15 66,587,012 (GRCm39) missense probably damaging 0.98
samarai UTSW 15 66,629,855 (GRCm39) critical splice donor site probably null
sariba UTSW 15 66,566,719 (GRCm39) missense probably benign 0.01
ticker UTSW 15 66,699,231 (GRCm39) nonsense probably null
Vampire UTSW 15 66,554,676 (GRCm39) missense probably damaging 1.00
IGL03134:Tg UTSW 15 66,612,567 (GRCm39) missense probably damaging 1.00
P0019:Tg UTSW 15 66,560,712 (GRCm39) missense probably benign 0.01
R0121:Tg UTSW 15 66,612,630 (GRCm39) missense probably benign 0.04
R0135:Tg UTSW 15 66,566,719 (GRCm39) missense probably benign 0.01
R0227:Tg UTSW 15 66,570,295 (GRCm39) missense possibly damaging 0.84
R0448:Tg UTSW 15 66,636,291 (GRCm39) missense probably damaging 1.00
R0453:Tg UTSW 15 66,700,382 (GRCm39) missense probably benign 0.09
R0504:Tg UTSW 15 66,554,253 (GRCm39) missense probably damaging 0.97
R0543:Tg UTSW 15 66,601,446 (GRCm39) missense probably benign 0.13
R0638:Tg UTSW 15 66,589,057 (GRCm39) missense probably damaging 0.99
R0639:Tg UTSW 15 66,613,333 (GRCm39) critical splice acceptor site probably null
R0646:Tg UTSW 15 66,601,475 (GRCm39) missense probably damaging 0.99
R0666:Tg UTSW 15 66,609,370 (GRCm39) missense probably benign
R0673:Tg UTSW 15 66,613,333 (GRCm39) critical splice acceptor site probably null
R0689:Tg UTSW 15 66,711,253 (GRCm39) splice site probably benign
R0704:Tg UTSW 15 66,629,729 (GRCm39) missense probably benign 0.02
R0730:Tg UTSW 15 66,550,638 (GRCm39) missense probably damaging 1.00
R0830:Tg UTSW 15 66,596,993 (GRCm39) missense probably damaging 1.00
R0959:Tg UTSW 15 66,579,859 (GRCm39) missense probably damaging 0.98
R1027:Tg UTSW 15 66,544,258 (GRCm39) missense possibly damaging 0.65
R1061:Tg UTSW 15 66,570,408 (GRCm39) missense probably benign 0.09
R1086:Tg UTSW 15 66,555,911 (GRCm39) missense probably benign
R1103:Tg UTSW 15 66,591,504 (GRCm39) missense probably benign 0.45
R1240:Tg UTSW 15 66,700,397 (GRCm39) missense probably benign 0.16
R1281:Tg UTSW 15 66,568,338 (GRCm39) missense probably benign 0.34
R1470:Tg UTSW 15 66,721,312 (GRCm39) missense possibly damaging 0.95
R1470:Tg UTSW 15 66,721,312 (GRCm39) missense possibly damaging 0.95
R1531:Tg UTSW 15 66,722,351 (GRCm39) missense probably benign 0.02
R1544:Tg UTSW 15 66,577,081 (GRCm39) missense probably benign 0.04
R1550:Tg UTSW 15 66,565,279 (GRCm39) missense possibly damaging 0.52
R1575:Tg UTSW 15 66,601,534 (GRCm39) critical splice donor site probably null
R1638:Tg UTSW 15 66,568,015 (GRCm39) nonsense probably null
R1655:Tg UTSW 15 66,700,417 (GRCm39) critical splice donor site probably null
R1671:Tg UTSW 15 66,564,236 (GRCm39) missense possibly damaging 0.89
R1789:Tg UTSW 15 66,609,397 (GRCm39) missense probably benign 0.00
R1883:Tg UTSW 15 66,543,158 (GRCm39) missense probably damaging 1.00
R1984:Tg UTSW 15 66,554,691 (GRCm39) missense probably benign
R2063:Tg UTSW 15 66,700,402 (GRCm39) missense probably damaging 1.00
R2092:Tg UTSW 15 66,721,456 (GRCm39) missense probably null 0.26
R2109:Tg UTSW 15 66,601,443 (GRCm39) missense probably benign 0.02
R2128:Tg UTSW 15 66,566,743 (GRCm39) missense probably benign 0.10
R2129:Tg UTSW 15 66,566,743 (GRCm39) missense probably benign 0.10
R2207:Tg UTSW 15 66,553,788 (GRCm39) missense probably benign 0.15
R2219:Tg UTSW 15 66,553,782 (GRCm39) missense probably benign 0.03
R2228:Tg UTSW 15 66,545,860 (GRCm39) missense probably damaging 0.99
R2229:Tg UTSW 15 66,545,860 (GRCm39) missense probably damaging 0.99
R2259:Tg UTSW 15 66,555,747 (GRCm39) missense probably benign
R2994:Tg UTSW 15 66,553,802 (GRCm39) missense probably benign
R3904:Tg UTSW 15 66,638,011 (GRCm39) nonsense probably null
R3946:Tg UTSW 15 66,545,872 (GRCm39) missense probably damaging 1.00
R3965:Tg UTSW 15 66,556,039 (GRCm39) missense probably benign
R4245:Tg UTSW 15 66,568,318 (GRCm39) missense possibly damaging 0.68
R4451:Tg UTSW 15 66,637,996 (GRCm39) missense probably benign 0.01
R4487:Tg UTSW 15 66,543,245 (GRCm39) missense probably damaging 1.00
R4489:Tg UTSW 15 66,579,791 (GRCm39) missense probably damaging 1.00
R4623:Tg UTSW 15 66,607,120 (GRCm39) missense probably benign 0.23
R4659:Tg UTSW 15 66,545,769 (GRCm39) missense possibly damaging 0.67
R4728:Tg UTSW 15 66,554,676 (GRCm39) missense probably damaging 1.00
R4760:Tg UTSW 15 66,565,168 (GRCm39) missense probably damaging 1.00
R4944:Tg UTSW 15 66,636,186 (GRCm39) missense probably damaging 1.00
R4998:Tg UTSW 15 66,545,899 (GRCm39) missense probably damaging 1.00
R5009:Tg UTSW 15 66,568,435 (GRCm39) missense probably benign 0.01
R5025:Tg UTSW 15 66,579,779 (GRCm39) missense probably damaging 1.00
R5035:Tg UTSW 15 66,553,662 (GRCm39) splice site probably null
R5049:Tg UTSW 15 66,699,231 (GRCm39) nonsense probably null
R5073:Tg UTSW 15 66,607,101 (GRCm39) missense probably benign 0.05
R5169:Tg UTSW 15 66,550,629 (GRCm39) nonsense probably null
R5185:Tg UTSW 15 66,645,323 (GRCm39) missense probably damaging 1.00
R5227:Tg UTSW 15 66,631,416 (GRCm39) missense possibly damaging 0.87
R5300:Tg UTSW 15 66,550,704 (GRCm39) missense probably damaging 1.00
R5334:Tg UTSW 15 66,549,904 (GRCm39) missense probably damaging 1.00
R5339:Tg UTSW 15 66,549,942 (GRCm39) missense probably damaging 1.00
R5402:Tg UTSW 15 66,611,017 (GRCm39) missense probably damaging 0.98
R5441:Tg UTSW 15 66,568,369 (GRCm39) missense possibly damaging 0.47
R5509:Tg UTSW 15 66,699,142 (GRCm39) missense probably benign 0.45
R5580:Tg UTSW 15 66,557,149 (GRCm39) missense possibly damaging 0.66
R5582:Tg UTSW 15 66,565,284 (GRCm39) missense probably damaging 1.00
R5624:Tg UTSW 15 66,709,906 (GRCm39) missense probably benign 0.11
R5686:Tg UTSW 15 66,560,738 (GRCm39) missense probably benign 0.28
R6042:Tg UTSW 15 66,555,842 (GRCm39) missense probably benign 0.01
R6122:Tg UTSW 15 66,700,306 (GRCm39) missense probably damaging 1.00
R6146:Tg UTSW 15 66,545,216 (GRCm39) splice site probably null
R6159:Tg UTSW 15 66,607,096 (GRCm39) missense possibly damaging 0.71
R6223:Tg UTSW 15 66,579,771 (GRCm39) missense probably benign 0.15
R6480:Tg UTSW 15 66,543,160 (GRCm39) missense probably damaging 1.00
R6505:Tg UTSW 15 66,631,407 (GRCm39) missense probably damaging 0.99
R6531:Tg UTSW 15 66,711,211 (GRCm39) missense probably damaging 0.99
R6614:Tg UTSW 15 66,607,108 (GRCm39) missense probably damaging 0.99
R6698:Tg UTSW 15 66,711,211 (GRCm39) missense probably damaging 1.00
R6798:Tg UTSW 15 66,550,688 (GRCm39) missense probably damaging 1.00
R6837:Tg UTSW 15 66,567,984 (GRCm39) missense probably damaging 1.00
R6861:Tg UTSW 15 66,560,740 (GRCm39) missense probably benign 0.00
R6888:Tg UTSW 15 66,568,095 (GRCm39) missense probably damaging 0.99
R6933:Tg UTSW 15 66,636,158 (GRCm39) missense possibly damaging 0.73
R6983:Tg UTSW 15 66,565,207 (GRCm39) missense probably benign 0.01
R7078:Tg UTSW 15 66,545,392 (GRCm39) missense probably damaging 1.00
R7244:Tg UTSW 15 66,612,563 (GRCm39) missense probably damaging 1.00
R7320:Tg UTSW 15 66,566,633 (GRCm39) missense possibly damaging 0.71
R7334:Tg UTSW 15 66,597,121 (GRCm39) missense probably benign 0.01
R7418:Tg UTSW 15 66,568,432 (GRCm39) missense probably damaging 0.99
R7485:Tg UTSW 15 66,568,437 (GRCm39) missense probably benign 0.04
R7524:Tg UTSW 15 66,568,010 (GRCm39) missense probably benign 0.01
R7529:Tg UTSW 15 66,566,617 (GRCm39) missense probably damaging 0.99
R7540:Tg UTSW 15 66,561,776 (GRCm39) missense probably benign 0.16
R7583:Tg UTSW 15 66,636,267 (GRCm39) missense probably damaging 1.00
R7594:Tg UTSW 15 66,601,432 (GRCm39) missense probably benign 0.20
R7667:Tg UTSW 15 66,587,012 (GRCm39) missense probably damaging 0.98
R7722:Tg UTSW 15 66,636,158 (GRCm39) missense possibly damaging 0.73
R7790:Tg UTSW 15 66,721,453 (GRCm39) missense probably damaging 0.99
R7838:Tg UTSW 15 66,565,112 (GRCm39) missense probably benign 0.00
R7890:Tg UTSW 15 66,555,663 (GRCm39) missense probably damaging 1.00
R7904:Tg UTSW 15 66,577,128 (GRCm39) missense probably benign 0.08
R7919:Tg UTSW 15 66,555,923 (GRCm39) missense possibly damaging 0.73
R7921:Tg UTSW 15 66,555,642 (GRCm39) missense probably benign 0.08
R8037:Tg UTSW 15 66,560,724 (GRCm39) missense probably benign 0.00
R8038:Tg UTSW 15 66,560,724 (GRCm39) missense probably benign 0.00
R8214:Tg UTSW 15 66,645,247 (GRCm39) missense probably damaging 1.00
R8304:Tg UTSW 15 66,565,109 (GRCm39) nonsense probably null
R8688:Tg UTSW 15 66,566,802 (GRCm39) critical splice donor site probably benign
R8709:Tg UTSW 15 66,553,786 (GRCm39) missense probably benign 0.08
R8714:Tg UTSW 15 66,555,891 (GRCm39) missense probably damaging 0.97
R8901:Tg UTSW 15 66,557,184 (GRCm39) missense probably damaging 1.00
R8917:Tg UTSW 15 66,645,332 (GRCm39) critical splice donor site probably null
R9023:Tg UTSW 15 66,555,522 (GRCm39) missense probably damaging 1.00
R9232:Tg UTSW 15 66,570,310 (GRCm39) missense probably benign 0.01
R9310:Tg UTSW 15 66,699,118 (GRCm39) missense possibly damaging 0.69
R9361:Tg UTSW 15 66,557,246 (GRCm39) missense possibly damaging 0.50
R9389:Tg UTSW 15 66,561,173 (GRCm39) missense probably benign 0.04
R9501:Tg UTSW 15 66,718,923 (GRCm39) missense possibly damaging 0.52
R9510:Tg UTSW 15 66,545,913 (GRCm39) missense probably damaging 1.00
R9594:Tg UTSW 15 66,607,109 (GRCm39) nonsense probably null
R9629:Tg UTSW 15 66,555,587 (GRCm39) missense possibly damaging 0.95
R9701:Tg UTSW 15 66,637,991 (GRCm39) missense probably benign 0.03
R9743:Tg UTSW 15 66,561,839 (GRCm39) missense probably benign 0.18
R9748:Tg UTSW 15 66,719,008 (GRCm39) missense possibly damaging 0.91
T0975:Tg UTSW 15 66,560,712 (GRCm39) missense probably benign 0.01
X0005:Tg UTSW 15 66,560,712 (GRCm39) missense probably benign 0.01
X0065:Tg UTSW 15 66,554,303 (GRCm39) missense probably damaging 1.00
X0067:Tg UTSW 15 66,620,592 (GRCm39) missense probably benign 0.10
Z1177:Tg UTSW 15 66,721,396 (GRCm39) missense probably benign 0.02
Z1177:Tg UTSW 15 66,557,159 (GRCm39) missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- CTCTTGCAGTAGTCTTCCACAG -3'
(R):5'- AACTAACTGTAGAGCGCCCAG -3'

Sequencing Primer
(F):5'- CTATTCCTGGTGCTAACTATATGTGG -3'
(R):5'- TGTAGAGCGCCCAGTGAGG -3'
Genotyping

Genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the mutation.
 

PCR Primers

R47970064_PCR_F: 5’- CTCTTGCAGTAGTCTTCCACAG-3’

R47970064_PCR_R: 5’- AACTAACTGTAGAGCGCCCAG-3’

Sequencing Primers

R47970064_SEQ_F: 5’- CTATTCCTGGTGCTAACTATATGTGG-3’
 

R47970064_SEQ_R: 5’- TGTAGAGCGCCCAGTGAGG-3’
 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               hold

The following sequence of 401 nucleotides is amplified (Chr15: 66757792-66758192; NC_000081):

ctcttgcagt agtcttccac agtcttcatt ctattcctgg tgctaactat atgtggttgt       

cccctgtttt gtctctcagt tacttcggac tcttggcaga ccctggccct gtcttcagtg      

attgtagatc catccatcaa gcactttgat gttgcccaca tcagcactgc agccaccagt      

aacttctcca tggcccaaga cttctgctta cagcgtaagg gaatccctca gagagagaga      

gagagagtat ggcagggtct tagccaagta ctgccctgtg cagcaaccaa agacagacag      

gagattcaat atggccttgg agtacctgac aggaaactac taacagagaa gggaagacat      

aagactctct ccactcctca ctgggcgctc tacagttagt t

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text (Chr. (+) = G>A).

Posted On 2016-02-04