Incidental Mutation 'R4798:Mier1'
ID 369198
Institutional Source Beutler Lab
Gene Symbol Mier1
Ensembl Gene ENSMUSG00000028522
Gene Name MEIR1 treanscription regulator
Synonyms 4933425I22Rik, 5830411K19Rik
MMRRC Submission 042422-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4798 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 102971587-103022951 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 102988195 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 40 (D40N)
Ref Sequence ENSEMBL: ENSMUSP00000102471 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030247] [ENSMUST00000097945] [ENSMUST00000106857] [ENSMUST00000106858] [ENSMUST00000134533]
AlphaFold Q5UAK0
Predicted Effect probably damaging
Transcript: ENSMUST00000030247
AA Change: D40N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030247
Gene: ENSMUSG00000028522
AA Change: D40N

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 57 65 N/A INTRINSIC
low complexity region 100 121 N/A INTRINSIC
low complexity region 176 193 N/A INTRINSIC
ELM2 198 251 1.14e-11 SMART
SANT 300 349 7.01e-9 SMART
low complexity region 382 409 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097945
AA Change: D68N

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000095558
Gene: ENSMUSG00000028522
AA Change: D68N

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 85 93 N/A INTRINSIC
low complexity region 128 149 N/A INTRINSIC
low complexity region 204 221 N/A INTRINSIC
ELM2 226 279 1.14e-11 SMART
SANT 328 377 7.01e-9 SMART
low complexity region 410 437 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106857
AA Change: D23N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102470
Gene: ENSMUSG00000028522
AA Change: D23N

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
low complexity region 40 48 N/A INTRINSIC
low complexity region 83 104 N/A INTRINSIC
low complexity region 159 176 N/A INTRINSIC
ELM2 181 234 1.14e-11 SMART
SANT 283 332 7.01e-9 SMART
low complexity region 365 392 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106858
AA Change: D40N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102471
Gene: ENSMUSG00000028522
AA Change: D40N

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 57 65 N/A INTRINSIC
low complexity region 100 121 N/A INTRINSIC
low complexity region 176 193 N/A INTRINSIC
ELM2 198 251 1.14e-11 SMART
SANT 300 349 7.01e-9 SMART
low complexity region 382 409 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124348
Predicted Effect probably benign
Transcript: ENSMUST00000134533
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137348
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149259
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151588
Meta Mutation Damage Score 0.1758 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 97% (111/114)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that was first identified in Xenopus laevis by its role in a mesoderm induction early response (MIER). The encoded protein functions as a transcriptional regulator. Alternatively spliced transcript variants encode multiple isoforms, some of which lack a C-terminal nuclear localization signal. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,471,843 (GRCm39) W1083R possibly damaging Het
Adamts10 T A 17: 33,747,726 (GRCm39) L54Q probably damaging Het
Ankrd24 A C 10: 81,479,149 (GRCm39) probably benign Het
Atg2b A G 12: 105,618,888 (GRCm39) S813P probably benign Het
Atp13a3 T A 16: 30,160,058 (GRCm39) I716F probably damaging Het
Atp6v1c1 T A 15: 38,689,420 (GRCm39) W294R probably damaging Het
Atrnl1 G T 19: 58,030,793 (GRCm39) A1312S probably benign Het
Bcl2 A T 1: 106,640,338 (GRCm39) H91Q possibly damaging Het
Cacna1c G A 6: 118,607,263 (GRCm39) Q1214* probably null Het
Cacna1g C A 11: 94,324,673 (GRCm39) G1183W probably damaging Het
Capsl A T 15: 9,461,828 (GRCm39) M75L probably benign Het
Ccdc122 T G 14: 77,349,047 (GRCm39) probably benign Het
Ccdc57 T G 11: 120,772,683 (GRCm39) R645S possibly damaging Het
Cdh8 T A 8: 99,751,558 (GRCm39) R720* probably null Het
Cenpx T G 11: 120,602,610 (GRCm39) probably benign Het
Clic3 T C 2: 25,348,194 (GRCm39) S114P probably damaging Het
Cracdl A T 1: 37,664,046 (GRCm39) D617E probably benign Het
Crtac1 A T 19: 42,312,240 (GRCm39) W158R possibly damaging Het
Dennd2b C T 7: 109,156,240 (GRCm39) G170D probably damaging Het
Dhrs11 T A 11: 84,719,626 (GRCm39) Q33L probably benign Het
Dnah8 G A 17: 30,967,542 (GRCm39) D2585N probably benign Het
Dpp9 G T 17: 56,498,016 (GRCm39) Q647K probably damaging Het
Egf C T 3: 129,510,327 (GRCm39) G64D probably damaging Het
Eif2b4 C T 5: 31,346,864 (GRCm39) probably benign Het
Epas1 A G 17: 87,113,267 (GRCm39) N151S probably benign Het
Fastkd1 A T 2: 69,521,651 (GRCm39) I707K probably benign Het
Fbln2 A G 6: 91,246,168 (GRCm39) T1005A probably benign Het
Fgfrl1 T A 5: 108,851,363 (GRCm39) Y93* probably null Het
Fktn A G 4: 53,744,637 (GRCm39) T306A probably benign Het
Gabbr2 T G 4: 46,991,139 (GRCm39) Y96S possibly damaging Het
Gm16332 A T 1: 139,819,396 (GRCm39) noncoding transcript Het
Gm5145 G T 17: 20,790,810 (GRCm39) V63F probably damaging Het
Gm9970 G T 5: 31,398,429 (GRCm39) probably benign Het
Gpr158 A G 2: 21,787,993 (GRCm39) T545A probably damaging Het
Heatr1 G A 13: 12,426,929 (GRCm39) E685K probably benign Het
Herc6 A T 6: 57,581,151 (GRCm39) I284F probably damaging Het
Hook1 C G 4: 95,890,794 (GRCm39) A301G possibly damaging Het
Hpcal4 T A 4: 123,084,491 (GRCm39) M140K possibly damaging Het
Il11ra1 T C 4: 41,766,096 (GRCm39) probably benign Het
Ildr1 A T 16: 36,542,917 (GRCm39) H439L possibly damaging Het
Itga11 A G 9: 62,684,009 (GRCm39) probably null Het
Jag2 A T 12: 112,880,252 (GRCm39) D337E probably benign Het
Krt82 C T 15: 101,458,923 (GRCm39) R39Q probably benign Het
L3mbtl4 T A 17: 68,666,475 (GRCm39) M1K probably null Het
Lrrc32 T G 7: 98,148,224 (GRCm39) F335V probably damaging Het
Lurap1l T A 4: 80,829,650 (GRCm39) V20E probably damaging Het
Lyar T A 5: 38,385,230 (GRCm39) V90D possibly damaging Het
Man2c1 C T 9: 57,048,469 (GRCm39) R778* probably null Het
Mapk6 A G 9: 75,295,714 (GRCm39) F595L probably benign Het
Mccc1 A G 3: 36,039,150 (GRCm39) I281T probably damaging Het
Mep1b T C 18: 21,226,311 (GRCm39) V391A probably damaging Het
Mkx T C 18: 7,002,432 (GRCm39) H38R probably benign Het
Mroh4 A G 15: 74,498,028 (GRCm39) L184P probably damaging Het
Muc2 C A 7: 141,307,877 (GRCm39) N834K probably benign Het
Mycl A G 4: 122,894,049 (GRCm39) D283G probably damaging Het
Myh6 T C 14: 55,190,750 (GRCm39) N975S probably damaging Het
Myl12a A G 17: 71,303,297 (GRCm39) probably benign Het
Mysm1 T C 4: 94,853,910 (GRCm39) T230A probably benign Het
Naca A G 10: 127,883,672 (GRCm39) K2099R probably null Het
Nbeal1 T G 1: 60,261,352 (GRCm39) probably null Het
Nedd1 A G 10: 92,534,772 (GRCm39) V246A probably benign Het
Nid2 A G 14: 19,839,829 (GRCm39) D806G probably benign Het
Ninl G A 2: 150,801,801 (GRCm39) R156* probably null Het
Obscn T A 11: 58,960,685 (GRCm39) I3418F probably damaging Het
Or8g37 T A 9: 39,731,193 (GRCm39) V86E probably benign Het
Pappa2 T C 1: 158,684,949 (GRCm39) N730S probably damaging Het
Pcm1 G A 8: 41,746,715 (GRCm39) D1305N probably damaging Het
Pcsk4 A T 10: 80,158,938 (GRCm39) I485N probably damaging Het
Phldb2 T C 16: 45,646,237 (GRCm39) R111G probably damaging Het
Prdm10 T C 9: 31,252,569 (GRCm39) F385S probably damaging Het
Prkcsh C T 9: 21,923,034 (GRCm39) P351L probably damaging Het
Prrc2a G A 17: 35,369,018 (GRCm39) P2006L probably damaging Het
Rad51c T C 11: 87,286,204 (GRCm39) D251G probably damaging Het
Radil A G 5: 142,470,918 (GRCm39) F1088L probably benign Het
Rere C A 4: 150,699,624 (GRCm39) probably benign Het
Rnf167 T A 11: 70,540,961 (GRCm39) C196S probably benign Het
Robo2 T A 16: 74,149,633 (GRCm39) Y65F probably damaging Het
Scarf2 G A 16: 17,621,371 (GRCm39) C319Y probably damaging Het
Sec24c A G 14: 20,743,780 (GRCm39) D995G probably damaging Het
Selenbp1 T C 3: 94,851,211 (GRCm39) L369S probably benign Het
Sgpl1 A T 10: 60,959,123 (GRCm39) I53K possibly damaging Het
Sh3bp5 C A 14: 31,099,452 (GRCm39) R265L probably benign Het
Slc1a6 A T 10: 78,635,952 (GRCm39) Y339F probably damaging Het
Smchd1 G T 17: 71,667,048 (GRCm39) Y1781* probably null Het
Smg1 T C 7: 117,779,697 (GRCm39) S1233G probably benign Het
Snap91 A T 9: 86,665,507 (GRCm39) probably benign Het
Snx29 T A 16: 11,238,600 (GRCm39) L112Q probably damaging Het
Sptbn5 T C 2: 119,889,622 (GRCm39) probably benign Het
Srl A T 16: 4,310,222 (GRCm39) H502Q possibly damaging Het
St8sia3 A G 18: 64,404,820 (GRCm39) M366V probably benign Het
Stk19 A T 17: 35,041,485 (GRCm39) probably benign Het
Syngap1 G A 17: 27,180,423 (GRCm39) A611T probably benign Het
Tas2r113 A G 6: 132,870,670 (GRCm39) T233A possibly damaging Het
Tbcc G A 17: 47,202,145 (GRCm39) W177* probably null Het
Tcstv3 T A 13: 120,779,618 (GRCm39) probably null Het
Trav13-5 T A 14: 54,033,408 (GRCm39) C106S probably damaging Het
Trmt61a G A 12: 111,645,147 (GRCm39) V28M possibly damaging Het
Ubap2l G A 3: 89,928,210 (GRCm39) T553M probably damaging Het
Urb1 T C 16: 90,554,715 (GRCm39) N1839S probably benign Het
Ush2a T C 1: 188,475,742 (GRCm39) L2893P probably damaging Het
Usp24 G A 4: 106,217,359 (GRCm39) V421M possibly damaging Het
Vmn1r43 T C 6: 89,846,892 (GRCm39) E198G probably benign Het
Vps13d A C 4: 144,904,626 (GRCm39) S130A probably damaging Het
Zfp426 T A 9: 20,382,310 (GRCm39) I211F probably benign Het
Znfx1 T C 2: 166,880,489 (GRCm39) probably null Het
Other mutations in Mier1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01586:Mier1 APN 4 103,012,769 (GRCm39) missense probably damaging 0.99
IGL01599:Mier1 APN 4 103,012,738 (GRCm39) missense possibly damaging 0.58
IGL01996:Mier1 APN 4 102,984,473 (GRCm39) missense possibly damaging 0.93
IGL02228:Mier1 APN 4 102,988,259 (GRCm39) missense possibly damaging 0.85
R0194:Mier1 UTSW 4 102,996,716 (GRCm39) splice site probably null
R0505:Mier1 UTSW 4 103,012,820 (GRCm39) splice site probably benign
R0684:Mier1 UTSW 4 102,996,631 (GRCm39) missense probably damaging 0.99
R0691:Mier1 UTSW 4 102,996,699 (GRCm39) missense probably benign 0.07
R2997:Mier1 UTSW 4 102,988,233 (GRCm39) missense probably damaging 1.00
R4273:Mier1 UTSW 4 103,019,628 (GRCm39) missense possibly damaging 0.93
R4728:Mier1 UTSW 4 102,997,402 (GRCm39) missense probably damaging 1.00
R4769:Mier1 UTSW 4 102,997,417 (GRCm39) missense probably benign 0.01
R5075:Mier1 UTSW 4 102,996,670 (GRCm39) missense probably benign 0.02
R5260:Mier1 UTSW 4 103,019,907 (GRCm39) missense probably benign 0.04
R5663:Mier1 UTSW 4 103,007,739 (GRCm39) missense probably damaging 0.96
R5924:Mier1 UTSW 4 103,016,899 (GRCm39) nonsense probably null
R7253:Mier1 UTSW 4 102,996,544 (GRCm39) splice site probably null
R7304:Mier1 UTSW 4 102,996,599 (GRCm39) nonsense probably null
R7641:Mier1 UTSW 4 102,996,637 (GRCm39) missense possibly damaging 0.89
R7998:Mier1 UTSW 4 103,019,812 (GRCm39) missense probably benign 0.09
R8000:Mier1 UTSW 4 102,988,240 (GRCm39) missense probably damaging 1.00
R8557:Mier1 UTSW 4 102,996,543 (GRCm39) splice site probably null
R9353:Mier1 UTSW 4 103,012,800 (GRCm39) missense probably damaging 0.97
R9537:Mier1 UTSW 4 103,019,758 (GRCm39) missense probably benign 0.00
R9759:Mier1 UTSW 4 103,019,725 (GRCm39) missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TTCCCTCTGCACAAAAGACTATTC -3'
(R):5'- TAAACAGCACCGAGGTCTCC -3'

Sequencing Primer
(F):5'- TCTGATCCTTTTTGACATACAT -3'
(R):5'- AGCACCGAGGTCTCCATGTC -3'
Posted On 2016-02-04