Mutagenetix > Incidental Mutation

Incidental Mutation 'R4798:St5'

369215

Institutional Source

Beutler Lab

Gene Symbol

St5

Ensembl Gene

ENSMUSG00000031024

Gene Name

suppression of tumorigenicity 5

Synonyms

2610305K15Rik, 2010004M01Rik

MMRRC Submission

042422-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.466) question?

Stock #

R4798 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

109523911-109703605 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 109557033 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Aspartic acid at position 170 (G170D)

Ref Sequence

ENSEMBL: ENSMUSP00000078264 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077909] [ENSMUST00000079282] [ENSMUST00000084738] [ENSMUST00000168005] [ENSMUST00000207394] [ENSMUST00000207745] [ENSMUST00000208583]

AlphaFold

Q924W7

Predicted Effect

probably damaging
Transcript: ENSMUST00000077909
AA Change: G170D

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000077067
Gene: ENSMUSG00000031024
AA Change: G170D

Domain	Start	End	E-Value	Type
low complexity region	28	46	N/A	INTRINSIC
low complexity region	197	213	N/A	INTRINSIC
low complexity region	314	326	N/A	INTRINSIC
low complexity region	327	348	N/A	INTRINSIC
low complexity region	365	379	N/A	INTRINSIC
low complexity region	407	426	N/A	INTRINSIC
low complexity region	577	609	N/A	INTRINSIC
low complexity region	624	638	N/A	INTRINSIC
low complexity region	645	656	N/A	INTRINSIC
uDENN	690	781	1.16e-30	SMART
DENN	788	972	7.84e-78	SMART
low complexity region	1007	1014	N/A	INTRINSIC
dDENN	1019	1086	3.12e-22	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000079282
AA Change: G170D

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000078264
Gene: ENSMUSG00000031024
AA Change: G170D

Domain	Start	End	E-Value	Type
low complexity region	28	46	N/A	INTRINSIC
low complexity region	197	213	N/A	INTRINSIC
low complexity region	314	326	N/A	INTRINSIC
low complexity region	327	348	N/A	INTRINSIC
low complexity region	365	379	N/A	INTRINSIC
low complexity region	407	426	N/A	INTRINSIC
low complexity region	577	609	N/A	INTRINSIC
low complexity region	624	638	N/A	INTRINSIC
low complexity region	645	656	N/A	INTRINSIC
uDENN	690	781	1.16e-30	SMART
DENN	788	972	7.84e-78	SMART
low complexity region	1007	1014	N/A	INTRINSIC
dDENN	1019	1086	3.12e-22	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000084738

SMART Domains

Protein: ENSMUSP00000081789
Gene: ENSMUSG00000031024

Domain	Start	End	E-Value	Type
low complexity region	160	192	N/A	INTRINSIC
low complexity region	207	221	N/A	INTRINSIC
low complexity region	228	239	N/A	INTRINSIC
uDENN	273	364	1.16e-30	SMART
DENN	371	555	7.84e-78	SMART
low complexity region	590	597	N/A	INTRINSIC
dDENN	602	669	3.12e-22	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000168005

SMART Domains

Protein: ENSMUSP00000130119
Gene: ENSMUSG00000031024

Domain	Start	End	E-Value	Type
low complexity region	160	192	N/A	INTRINSIC
low complexity region	207	221	N/A	INTRINSIC
low complexity region	228	239	N/A	INTRINSIC
uDENN	273	364	1.16e-30	SMART
DENN	371	555	7.84e-78	SMART
low complexity region	590	597	N/A	INTRINSIC
dDENN	602	669	3.12e-22	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000207394

Predicted Effect

probably benign
Transcript: ENSMUST00000207745

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208557

Predicted Effect

probably benign
Transcript: ENSMUST00000208583

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208981

Meta Mutation Damage Score

0.1546

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.6%

Validation Efficiency

97% (111/114)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by its ability to suppress the tumorigenicity of Hela cells in nude mice. The protein encoded by this gene contains a C-terminal region that shares similarity with the Rab 3 family of small GTP binding proteins. This protein preferentially binds to the SH3 domain of c-Abl kinase, and acts as a regulator of MAPK1/ERK2 kinase, which may contribute to its ability to reduce the tumorigenic phenotype in cells. Three alternatively spliced transcript variants of this gene encoding distinct isoforms are identified. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 105 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010300C02Rik	A	T	1: 37,624,965	D617E	probably benign	Het
2210408I21Rik	T	C	13: 77,323,724	W1083R	possibly damaging	Het
Adamts10	T	A	17: 33,528,752	L54Q	probably damaging	Het
Ankrd24	A	C	10: 81,643,315		probably benign	Het
Atg2b	A	G	12: 105,652,629	S813P	probably benign	Het
Atp13a3	T	A	16: 30,341,240	I716F	probably damaging	Het
Atp6v1c1	T	A	15: 38,689,176	W294R	probably damaging	Het
Atrnl1	G	T	19: 58,042,361	A1312S	probably benign	Het
B230359F08Rik	T	A	14: 53,795,951	C106S	probably damaging	Het
Bcl2	A	T	1: 106,712,608	H91Q	possibly damaging	Het
Cacna1c	G	A	6: 118,630,302	Q1214*	probably null	Het
Cacna1g	C	A	11: 94,433,847	G1183W	probably damaging	Het
Capsl	A	T	15: 9,461,742	M75L	probably benign	Het
Ccdc122	T	G	14: 77,111,607		probably benign	Het
Ccdc57	T	G	11: 120,881,857	R645S	possibly damaging	Het
Cdh8	T	A	8: 99,024,926	R720*	probably null	Het
Cenpx	T	G	11: 120,711,784		probably benign	Het
Clic3	T	C	2: 25,458,182	S114P	probably damaging	Het
Crtac1	A	T	19: 42,323,801	W158R	possibly damaging	Het
Dhrs11	T	A	11: 84,828,800	Q33L	probably benign	Het
Dnah8	G	A	17: 30,748,568	D2585N	probably benign	Het
Dpp9	G	T	17: 56,191,016	Q647K	probably damaging	Het
Egf	C	T	3: 129,716,678	G64D	probably damaging	Het
Eif2b4	C	T	5: 31,189,520		probably benign	Het
Epas1	A	G	17: 86,805,839	N151S	probably benign	Het
Fastkd1	A	T	2: 69,691,307	I707K	probably benign	Het
Fbln2	A	G	6: 91,269,186	T1005A	probably benign	Het
Fgfrl1	T	A	5: 108,703,497	Y93*	probably null	Het
Fktn	A	G	4: 53,744,637	T306A	probably benign	Het
Gabbr2	T	G	4: 46,991,139	Y96S	possibly damaging	Het
Gm16332	A	T	1: 139,891,658		noncoding transcript	Het
Gm5145	G	T	17: 20,570,548	V63F	probably damaging	Het
Gm9970	G	T	5: 31,241,085		probably benign	Het
Gpr158	A	G	2: 21,783,182	T545A	probably damaging	Het
Heatr1	G	A	13: 12,412,048	E685K	probably benign	Het
Herc6	A	T	6: 57,604,166	I284F	probably damaging	Het
Hook1	C	G	4: 96,002,557	A301G	possibly damaging	Het
Hpcal4	T	A	4: 123,190,698	M140K	possibly damaging	Het
Il11ra1	T	C	4: 41,766,096		probably benign	Het
Ildr1	A	T	16: 36,722,555	H439L	possibly damaging	Het
Itga11	A	G	9: 62,776,727		probably null	Het
Jag2	A	T	12: 112,916,632	D337E	probably benign	Het
Krt82	C	T	15: 101,550,488	R39Q	probably benign	Het
L3mbtl4	T	A	17: 68,359,480	M1K	probably null	Het
Lrrc32	T	G	7: 98,499,017	F335V	probably damaging	Het
Lurap1l	T	A	4: 80,911,413	V20E	probably damaging	Het
Lyar	T	A	5: 38,227,886	V90D	possibly damaging	Het
Man2c1	C	T	9: 57,141,185	R778*	probably null	Het
Mapk6	A	G	9: 75,388,432	F595L	probably benign	Het
Mccc1	A	G	3: 35,985,001	I281T	probably damaging	Het
Mep1b	T	C	18: 21,093,254	V391A	probably damaging	Het
Mier1	G	A	4: 103,130,998	D40N	probably damaging	Het
Mkx	T	C	18: 7,002,432	H38R	probably benign	Het
Mroh4	A	G	15: 74,626,179	L184P	probably damaging	Het
Muc2	C	A	7: 141,754,140	N834K	probably benign	Het
Mycl	A	G	4: 123,000,256	D283G	probably damaging	Het
Myh6	T	C	14: 54,953,293	N975S	probably damaging	Het
Myl12a	A	G	17: 70,996,302		probably benign	Het
Mysm1	T	C	4: 94,965,673	T230A	probably benign	Het
Naca	A	G	10: 128,047,803	K2099R	probably null	Het
Nbeal1	T	G	1: 60,222,193		probably null	Het
Nedd1	A	G	10: 92,698,910	V246A	probably benign	Het
Nid2	A	G	14: 19,789,761	D806G	probably benign	Het
Ninl	G	A	2: 150,959,881	R156*	probably null	Het
Obscn	T	A	11: 59,069,859	I3418F	probably damaging	Het
Olfr970	T	A	9: 39,819,897	V86E	probably benign	Het
Pappa2	T	C	1: 158,857,379	N730S	probably damaging	Het
Pcm1	G	A	8: 41,293,678	D1305N	probably damaging	Het
Pcsk4	A	T	10: 80,323,104	I485N	probably damaging	Het
Phldb2	T	C	16: 45,825,874	R111G	probably damaging	Het
Prdm10	T	C	9: 31,341,273	F385S	probably damaging	Het
Prkcsh	C	T	9: 22,011,738	P351L	probably damaging	Het
Prrc2a	G	A	17: 35,150,042	P2006L	probably damaging	Het
Rad51c	T	C	11: 87,395,378	D251G	probably damaging	Het
Radil	A	G	5: 142,485,163	F1088L	probably benign	Het
Rere	C	A	4: 150,615,167		probably benign	Het
Rnf167	T	A	11: 70,650,135	C196S	probably benign	Het
Robo2	T	A	16: 74,352,745	Y65F	probably damaging	Het
Scarf2	G	A	16: 17,803,507	C319Y	probably damaging	Het
Sec24c	A	G	14: 20,693,712	D995G	probably damaging	Het
Selenbp1	T	C	3: 94,943,900	L369S	probably benign	Het
Sgpl1	A	T	10: 61,123,344	I53K	possibly damaging	Het
Sh3bp5	C	A	14: 31,377,495	R265L	probably benign	Het
Slc1a6	A	T	10: 78,800,118	Y339F	probably damaging	Het
Smchd1	G	T	17: 71,360,053	Y1781*	probably null	Het
Smg1	T	C	7: 118,180,474	S1233G	probably benign	Het
Snap91	A	T	9: 86,783,454		probably benign	Het
Snx29	T	A	16: 11,420,736	L112Q	probably damaging	Het
Sptbn5	T	C	2: 120,059,141		probably benign	Het
Srl	A	T	16: 4,492,358	H502Q	possibly damaging	Het
St8sia3	A	G	18: 64,271,749	M366V	probably benign	Het
Stk19	A	T	17: 34,822,509		probably benign	Het
Syngap1	G	A	17: 26,961,449	A611T	probably benign	Het
Tas2r113	A	G	6: 132,893,707	T233A	possibly damaging	Het
Tbcc	G	A	17: 46,891,219	W177*	probably null	Het
Tcstv3	T	A	13: 120,318,082		probably null	Het
Trmt61a	G	A	12: 111,678,713	V28M	possibly damaging	Het
Ubap2l	G	A	3: 90,020,903	T553M	probably damaging	Het
Urb1	T	C	16: 90,757,827	N1839S	probably benign	Het
Ush2a	T	C	1: 188,743,545	L2893P	probably damaging	Het
Usp24	G	A	4: 106,360,162	V421M	possibly damaging	Het
Vmn1r43	T	C	6: 89,869,910	E198G	probably benign	Het
Vps13d	A	C	4: 145,178,056	S130A	probably damaging	Het
Zfp426	T	A	9: 20,471,014	I211F	probably benign	Het
Znfx1	T	C	2: 167,038,569		probably null	Het

Other mutations in St5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00493:St5	APN	7	109527708	missense	possibly damaging	0.71
IGL01132:St5	APN	7	109570005	splice site	probably null
IGL01288:St5	APN	7	109539822	missense	probably damaging	0.96
IGL01645:St5	APN	7	109527634	nonsense	probably null
IGL01714:St5	APN	7	109570062	missense	probably damaging	0.99
IGL02021:St5	APN	7	109557372	missense	probably damaging	1.00
IGL02302:St5	APN	7	109525331	missense	probably damaging	1.00
IGL02496:St5	APN	7	109556235	missense	possibly damaging	0.83
IGL02795:St5	APN	7	109556364	missense	probably damaging	1.00
Bucolic	UTSW	7	109525548	nonsense	probably null
Halcyon	UTSW	7	109556793	nonsense	probably null
FR4340:St5	UTSW	7	109556921	unclassified	probably benign
FR4737:St5	UTSW	7	109556921	unclassified	probably benign
PIT4466001:St5	UTSW	7	109531130	missense	probably damaging	1.00
PIT4469001:St5	UTSW	7	109531130	missense	probably damaging	1.00
PIT4472001:St5	UTSW	7	109531130	missense	probably damaging	1.00
R0024:St5	UTSW	7	109524659	missense	probably damaging	1.00
R0124:St5	UTSW	7	109542511	missense	possibly damaging	0.66
R0125:St5	UTSW	7	109556338	missense	probably benign	0.19
R0365:St5	UTSW	7	109538949	missense	probably damaging	1.00
R0491:St5	UTSW	7	109557204	missense	probably benign	0.45
R0534:St5	UTSW	7	109541428	missense	probably damaging	1.00
R0662:St5	UTSW	7	109557426	missense	probably damaging	1.00
R0743:St5	UTSW	7	109557345	missense	probably damaging	1.00
R0772:St5	UTSW	7	109542320	splice site	probably null
R0774:St5	UTSW	7	109542320	splice site	probably null
R0787:St5	UTSW	7	109525620	missense	possibly damaging	0.94
R0884:St5	UTSW	7	109557345	missense	probably damaging	1.00
R1518:St5	UTSW	7	109557355	missense	probably damaging	1.00
R1908:St5	UTSW	7	109525326	nonsense	probably null
R1909:St5	UTSW	7	109525326	nonsense	probably null
R2232:St5	UTSW	7	109557207	missense	probably benign
R2358:St5	UTSW	7	109556446	missense	probably benign	0.01
R2847:St5	UTSW	7	109525337	missense	probably damaging	1.00
R2869:St5	UTSW	7	109557430	missense	probably benign	0.01
R2869:St5	UTSW	7	109557430	missense	probably benign	0.01
R2870:St5	UTSW	7	109557430	missense	probably benign	0.01
R2870:St5	UTSW	7	109557430	missense	probably benign	0.01
R2871:St5	UTSW	7	109557430	missense	probably benign	0.01
R2871:St5	UTSW	7	109557430	missense	probably benign	0.01
R2873:St5	UTSW	7	109557430	missense	probably benign	0.01
R2874:St5	UTSW	7	109557430	missense	probably benign	0.01
R4534:St5	UTSW	7	109531156	missense	probably damaging	1.00
R4536:St5	UTSW	7	109531156	missense	probably damaging	1.00
R4559:St5	UTSW	7	109525578	missense	probably damaging	1.00
R4846:St5	UTSW	7	109556836	nonsense	probably null
R5110:St5	UTSW	7	109542490	missense	probably benign	0.02
R5181:St5	UTSW	7	109556790	missense	probably benign
R5268:St5	UTSW	7	109557312	missense	probably benign
R5403:St5	UTSW	7	109556905	missense	probably damaging	1.00
R5836:St5	UTSW	7	109541345	missense	possibly damaging	0.78
R5932:St5	UTSW	7	109570016	missense	probably damaging	1.00
R5937:St5	UTSW	7	109557271	missense	possibly damaging	0.86
R6180:St5	UTSW	7	109556888	missense	probably benign	0.11
R6741:St5	UTSW	7	109545097	missense	possibly damaging	0.95
R6781:St5	UTSW	7	109525304	missense	possibly damaging	0.83
R7086:St5	UTSW	7	109525574	missense	probably damaging	1.00
R7466:St5	UTSW	7	109525346	missense	probably damaging	1.00
R7644:St5	UTSW	7	109556793	nonsense	probably null
R8354:St5	UTSW	7	109525548	nonsense	probably null
R8745:St5	UTSW	7	109557072	missense	probably benign	0.02
R8859:St5	UTSW	7	109524656	missense	probably damaging	1.00
R9016:St5	UTSW	7	109540435	missense	possibly damaging	0.84
R9178:St5	UTSW	7	109557084	missense	probably benign	0.31
R9361:St5	UTSW	7	109527784	missense	probably damaging	1.00
R9564:St5	UTSW	7	109526329	missense	probably damaging	1.00
R9595:St5	UTSW	7	109556766	missense	probably damaging	0.96
RF062:St5	UTSW	7	109556946	unclassified	probably benign
X0067:St5	UTSW	7	109556240	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ACTCAGAGAAGGTCCTGCTC -3'
(R):5'- AGCTATTTGGACAGAACCCC -3'

Sequencing Primer
(F):5'- AGAGAAGGTCCTGCTCATCCTC -3'
(R):5'- ATTTGGACAGAACCCCTTCATTACG -3'

Posted On

2016-02-04