Incidental Mutation 'R4798:Jag2'
ID 369242
Institutional Source Beutler Lab
Gene Symbol Jag2
Ensembl Gene ENSMUSG00000002799
Gene Name jagged 2
Synonyms D12Ggc2e, Serh
MMRRC Submission 042422-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4798 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 112871439-112893396 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 112880252 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 337 (D337E)
Ref Sequence ENSEMBL: ENSMUSP00000075224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075827]
AlphaFold Q9QYE5
Predicted Effect probably benign
Transcript: ENSMUST00000075827
AA Change: D337E

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000075224
Gene: ENSMUSG00000002799
AA Change: D337E

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:MNNL 26 105 4.2e-31 PFAM
low complexity region 108 123 N/A INTRINSIC
DSL 178 240 1.48e-36 SMART
EGF_like 244 274 7.23e1 SMART
EGF 275 305 4.56e0 SMART
EGF_CA 307 345 8.5e-9 SMART
EGF 350 383 4e-5 SMART
EGF_CA 385 421 5.39e-11 SMART
EGF_CA 423 459 3.51e-10 SMART
EGF_CA 461 496 1.01e-10 SMART
EGF_CA 498 534 1.17e-6 SMART
EGF_CA 536 572 6.35e-8 SMART
EGF 588 634 7.53e-1 SMART
EGF_CA 636 672 2.89e-11 SMART
EGF 677 710 3.68e-4 SMART
EGF 715 748 1.32e-5 SMART
EGF 754 787 1.34e-6 SMART
EGF_CA 789 825 2.58e-8 SMART
EGF_CA 827 863 7.23e-12 SMART
VWC 872 949 1.3e-1 SMART
low complexity region 1002 1035 N/A INTRINSIC
transmembrane domain 1085 1107 N/A INTRINSIC
low complexity region 1109 1119 N/A INTRINSIC
low complexity region 1170 1199 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184711
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220771
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220855
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221320
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221647
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221696
Predicted Effect probably benign
Transcript: ENSMUST00000223140
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 97% (111/114)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Notch signaling pathway is an intercellular signaling mechanism that is essential for proper embryonic development. Members of the Notch gene family encode transmembrane receptors that are critical for various cell fate decisions. The protein encoded by this gene is one of several ligands that activate Notch and related receptors. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation die perinatally with craniofacial defects, fused digits, and increased numbers of sensory hair cells in the cochlea. Homozygotes for a spontaneous mutation exhibit fused digits and sometimes tail kinks. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,471,843 (GRCm39) W1083R possibly damaging Het
Adamts10 T A 17: 33,747,726 (GRCm39) L54Q probably damaging Het
Ankrd24 A C 10: 81,479,149 (GRCm39) probably benign Het
Atg2b A G 12: 105,618,888 (GRCm39) S813P probably benign Het
Atp13a3 T A 16: 30,160,058 (GRCm39) I716F probably damaging Het
Atp6v1c1 T A 15: 38,689,420 (GRCm39) W294R probably damaging Het
Atrnl1 G T 19: 58,030,793 (GRCm39) A1312S probably benign Het
Bcl2 A T 1: 106,640,338 (GRCm39) H91Q possibly damaging Het
Cacna1c G A 6: 118,607,263 (GRCm39) Q1214* probably null Het
Cacna1g C A 11: 94,324,673 (GRCm39) G1183W probably damaging Het
Capsl A T 15: 9,461,828 (GRCm39) M75L probably benign Het
Ccdc122 T G 14: 77,349,047 (GRCm39) probably benign Het
Ccdc57 T G 11: 120,772,683 (GRCm39) R645S possibly damaging Het
Cdh8 T A 8: 99,751,558 (GRCm39) R720* probably null Het
Cenpx T G 11: 120,602,610 (GRCm39) probably benign Het
Clic3 T C 2: 25,348,194 (GRCm39) S114P probably damaging Het
Cracdl A T 1: 37,664,046 (GRCm39) D617E probably benign Het
Crtac1 A T 19: 42,312,240 (GRCm39) W158R possibly damaging Het
Dennd2b C T 7: 109,156,240 (GRCm39) G170D probably damaging Het
Dhrs11 T A 11: 84,719,626 (GRCm39) Q33L probably benign Het
Dnah8 G A 17: 30,967,542 (GRCm39) D2585N probably benign Het
Dpp9 G T 17: 56,498,016 (GRCm39) Q647K probably damaging Het
Egf C T 3: 129,510,327 (GRCm39) G64D probably damaging Het
Eif2b4 C T 5: 31,346,864 (GRCm39) probably benign Het
Epas1 A G 17: 87,113,267 (GRCm39) N151S probably benign Het
Fastkd1 A T 2: 69,521,651 (GRCm39) I707K probably benign Het
Fbln2 A G 6: 91,246,168 (GRCm39) T1005A probably benign Het
Fgfrl1 T A 5: 108,851,363 (GRCm39) Y93* probably null Het
Fktn A G 4: 53,744,637 (GRCm39) T306A probably benign Het
Gabbr2 T G 4: 46,991,139 (GRCm39) Y96S possibly damaging Het
Gm16332 A T 1: 139,819,396 (GRCm39) noncoding transcript Het
Gm5145 G T 17: 20,790,810 (GRCm39) V63F probably damaging Het
Gm9970 G T 5: 31,398,429 (GRCm39) probably benign Het
Gpr158 A G 2: 21,787,993 (GRCm39) T545A probably damaging Het
Heatr1 G A 13: 12,426,929 (GRCm39) E685K probably benign Het
Herc6 A T 6: 57,581,151 (GRCm39) I284F probably damaging Het
Hook1 C G 4: 95,890,794 (GRCm39) A301G possibly damaging Het
Hpcal4 T A 4: 123,084,491 (GRCm39) M140K possibly damaging Het
Il11ra1 T C 4: 41,766,096 (GRCm39) probably benign Het
Ildr1 A T 16: 36,542,917 (GRCm39) H439L possibly damaging Het
Itga11 A G 9: 62,684,009 (GRCm39) probably null Het
Krt82 C T 15: 101,458,923 (GRCm39) R39Q probably benign Het
L3mbtl4 T A 17: 68,666,475 (GRCm39) M1K probably null Het
Lrrc32 T G 7: 98,148,224 (GRCm39) F335V probably damaging Het
Lurap1l T A 4: 80,829,650 (GRCm39) V20E probably damaging Het
Lyar T A 5: 38,385,230 (GRCm39) V90D possibly damaging Het
Man2c1 C T 9: 57,048,469 (GRCm39) R778* probably null Het
Mapk6 A G 9: 75,295,714 (GRCm39) F595L probably benign Het
Mccc1 A G 3: 36,039,150 (GRCm39) I281T probably damaging Het
Mep1b T C 18: 21,226,311 (GRCm39) V391A probably damaging Het
Mier1 G A 4: 102,988,195 (GRCm39) D40N probably damaging Het
Mkx T C 18: 7,002,432 (GRCm39) H38R probably benign Het
Mroh4 A G 15: 74,498,028 (GRCm39) L184P probably damaging Het
Muc2 C A 7: 141,307,877 (GRCm39) N834K probably benign Het
Mycl A G 4: 122,894,049 (GRCm39) D283G probably damaging Het
Myh6 T C 14: 55,190,750 (GRCm39) N975S probably damaging Het
Myl12a A G 17: 71,303,297 (GRCm39) probably benign Het
Mysm1 T C 4: 94,853,910 (GRCm39) T230A probably benign Het
Naca A G 10: 127,883,672 (GRCm39) K2099R probably null Het
Nbeal1 T G 1: 60,261,352 (GRCm39) probably null Het
Nedd1 A G 10: 92,534,772 (GRCm39) V246A probably benign Het
Nid2 A G 14: 19,839,829 (GRCm39) D806G probably benign Het
Ninl G A 2: 150,801,801 (GRCm39) R156* probably null Het
Obscn T A 11: 58,960,685 (GRCm39) I3418F probably damaging Het
Or8g37 T A 9: 39,731,193 (GRCm39) V86E probably benign Het
Pappa2 T C 1: 158,684,949 (GRCm39) N730S probably damaging Het
Pcm1 G A 8: 41,746,715 (GRCm39) D1305N probably damaging Het
Pcsk4 A T 10: 80,158,938 (GRCm39) I485N probably damaging Het
Phldb2 T C 16: 45,646,237 (GRCm39) R111G probably damaging Het
Prdm10 T C 9: 31,252,569 (GRCm39) F385S probably damaging Het
Prkcsh C T 9: 21,923,034 (GRCm39) P351L probably damaging Het
Prrc2a G A 17: 35,369,018 (GRCm39) P2006L probably damaging Het
Rad51c T C 11: 87,286,204 (GRCm39) D251G probably damaging Het
Radil A G 5: 142,470,918 (GRCm39) F1088L probably benign Het
Rere C A 4: 150,699,624 (GRCm39) probably benign Het
Rnf167 T A 11: 70,540,961 (GRCm39) C196S probably benign Het
Robo2 T A 16: 74,149,633 (GRCm39) Y65F probably damaging Het
Scarf2 G A 16: 17,621,371 (GRCm39) C319Y probably damaging Het
Sec24c A G 14: 20,743,780 (GRCm39) D995G probably damaging Het
Selenbp1 T C 3: 94,851,211 (GRCm39) L369S probably benign Het
Sgpl1 A T 10: 60,959,123 (GRCm39) I53K possibly damaging Het
Sh3bp5 C A 14: 31,099,452 (GRCm39) R265L probably benign Het
Slc1a6 A T 10: 78,635,952 (GRCm39) Y339F probably damaging Het
Smchd1 G T 17: 71,667,048 (GRCm39) Y1781* probably null Het
Smg1 T C 7: 117,779,697 (GRCm39) S1233G probably benign Het
Snap91 A T 9: 86,665,507 (GRCm39) probably benign Het
Snx29 T A 16: 11,238,600 (GRCm39) L112Q probably damaging Het
Sptbn5 T C 2: 119,889,622 (GRCm39) probably benign Het
Srl A T 16: 4,310,222 (GRCm39) H502Q possibly damaging Het
St8sia3 A G 18: 64,404,820 (GRCm39) M366V probably benign Het
Stk19 A T 17: 35,041,485 (GRCm39) probably benign Het
Syngap1 G A 17: 27,180,423 (GRCm39) A611T probably benign Het
Tas2r113 A G 6: 132,870,670 (GRCm39) T233A possibly damaging Het
Tbcc G A 17: 47,202,145 (GRCm39) W177* probably null Het
Tcstv3 T A 13: 120,779,618 (GRCm39) probably null Het
Trav13-5 T A 14: 54,033,408 (GRCm39) C106S probably damaging Het
Trmt61a G A 12: 111,645,147 (GRCm39) V28M possibly damaging Het
Ubap2l G A 3: 89,928,210 (GRCm39) T553M probably damaging Het
Urb1 T C 16: 90,554,715 (GRCm39) N1839S probably benign Het
Ush2a T C 1: 188,475,742 (GRCm39) L2893P probably damaging Het
Usp24 G A 4: 106,217,359 (GRCm39) V421M possibly damaging Het
Vmn1r43 T C 6: 89,846,892 (GRCm39) E198G probably benign Het
Vps13d A C 4: 144,904,626 (GRCm39) S130A probably damaging Het
Zfp426 T A 9: 20,382,310 (GRCm39) I211F probably benign Het
Znfx1 T C 2: 166,880,489 (GRCm39) probably null Het
Other mutations in Jag2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Jag2 APN 12 112,876,338 (GRCm39) missense probably benign 0.20
IGL00954:Jag2 APN 12 112,884,026 (GRCm39) missense possibly damaging 0.50
IGL01532:Jag2 APN 12 112,877,983 (GRCm39) missense probably damaging 0.98
IGL01646:Jag2 APN 12 112,879,969 (GRCm39) missense possibly damaging 0.65
IGL02243:Jag2 APN 12 112,879,965 (GRCm39) missense possibly damaging 0.94
IGL02447:Jag2 APN 12 112,876,232 (GRCm39) missense probably damaging 1.00
IGL02458:Jag2 APN 12 112,879,613 (GRCm39) missense probably damaging 0.98
IGL02516:Jag2 APN 12 112,874,186 (GRCm39) missense probably damaging 1.00
IGL02574:Jag2 APN 12 112,879,131 (GRCm39) missense probably benign 0.32
IGL02629:Jag2 APN 12 112,878,134 (GRCm39) splice site probably benign
IGL02873:Jag2 APN 12 112,874,122 (GRCm39) missense probably benign 0.00
IGL03087:Jag2 APN 12 112,877,568 (GRCm39) missense possibly damaging 0.60
Jaguarundi UTSW 12 112,879,089 (GRCm39) critical splice donor site probably null
R0068:Jag2 UTSW 12 112,878,813 (GRCm39) splice site probably benign
R0310:Jag2 UTSW 12 112,876,997 (GRCm39) unclassified probably benign
R0963:Jag2 UTSW 12 112,878,934 (GRCm39) missense probably damaging 1.00
R1188:Jag2 UTSW 12 112,883,741 (GRCm39) nonsense probably null
R1256:Jag2 UTSW 12 112,878,039 (GRCm39) missense possibly damaging 0.50
R1298:Jag2 UTSW 12 112,879,939 (GRCm39) unclassified probably benign
R1317:Jag2 UTSW 12 112,878,121 (GRCm39) missense probably benign
R2079:Jag2 UTSW 12 112,883,997 (GRCm39) missense probably damaging 1.00
R2345:Jag2 UTSW 12 112,872,684 (GRCm39) missense probably damaging 1.00
R4654:Jag2 UTSW 12 112,877,266 (GRCm39) missense probably benign 0.13
R4782:Jag2 UTSW 12 112,877,869 (GRCm39) missense probably benign
R5242:Jag2 UTSW 12 112,880,486 (GRCm39) missense probably damaging 0.97
R5350:Jag2 UTSW 12 112,872,542 (GRCm39) missense possibly damaging 0.77
R5364:Jag2 UTSW 12 112,874,154 (GRCm39) missense probably damaging 1.00
R6129:Jag2 UTSW 12 112,883,969 (GRCm39) nonsense probably null
R6362:Jag2 UTSW 12 112,883,742 (GRCm39) missense probably damaging 0.97
R6376:Jag2 UTSW 12 112,872,949 (GRCm39) missense probably benign 0.00
R6819:Jag2 UTSW 12 112,874,161 (GRCm39) missense probably damaging 1.00
R6844:Jag2 UTSW 12 112,880,334 (GRCm39) missense probably damaging 1.00
R6968:Jag2 UTSW 12 112,877,878 (GRCm39) missense probably benign 0.10
R7514:Jag2 UTSW 12 112,892,672 (GRCm39) missense probably benign 0.19
R7663:Jag2 UTSW 12 112,877,286 (GRCm39) missense probably damaging 1.00
R7730:Jag2 UTSW 12 112,885,661 (GRCm39) missense probably damaging 1.00
R7754:Jag2 UTSW 12 112,879,089 (GRCm39) critical splice donor site probably null
R7828:Jag2 UTSW 12 112,876,800 (GRCm39) missense probably benign 0.19
R7874:Jag2 UTSW 12 112,879,566 (GRCm39) missense probably damaging 0.99
R8075:Jag2 UTSW 12 112,878,894 (GRCm39) missense probably benign 0.05
R8845:Jag2 UTSW 12 112,883,714 (GRCm39) missense probably damaging 1.00
R8876:Jag2 UTSW 12 112,873,257 (GRCm39) missense probably benign 0.00
R9117:Jag2 UTSW 12 112,877,279 (GRCm39) nonsense probably null
R9400:Jag2 UTSW 12 112,875,608 (GRCm39) nonsense probably null
R9673:Jag2 UTSW 12 112,875,416 (GRCm39) nonsense probably null
R9688:Jag2 UTSW 12 112,872,564 (GRCm39) missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- AGCTGCAGAACCAGAACATG -3'
(R):5'- TGTGACTGTGAGACCAACTGG -3'

Sequencing Primer
(F):5'- ATGAGTGGAGCGATGCCCAC -3'
(R):5'- CCTGCTCTGTGACAAAGGTAG -3'
Posted On 2016-02-04