Incidental Mutation 'R0419:Ntn4'
ID 36937
Institutional Source Beutler Lab
Gene Symbol Ntn4
Ensembl Gene ENSMUSG00000020019
Gene Name netrin 4
Synonyms beta-netrin
MMRRC Submission 038621-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0419 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 93640681-93747207 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 93682429 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 199 (R199S)
Ref Sequence ENSEMBL: ENSMUSP00000020204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020204]
AlphaFold Q9JI33
Predicted Effect probably benign
Transcript: ENSMUST00000020204
AA Change: R199S

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000020204
Gene: ENSMUSG00000020019
AA Change: R199S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LamNT 28 260 6.48e-55 SMART
EGF_Lam 262 329 5.83e-7 SMART
EGF_Lam 332 392 3.32e-11 SMART
EGF_Lam 395 446 3.73e-14 SMART
C345C 516 625 5.58e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147379
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.8%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the netrin family of proteins, which function in various biological processes including axon guidance, tumorogenesis, and angiogenesis. Netrins are laminin-related proteins that have an N-terminal laminin-type domain, epidermal growth factor-like repeat domain, and a positively charged heparin-binding domain at the C-terminus. The protein encoded by this gene is involved in processes including neurite growth and migration, angiogenesis and mural cell adhesion to endothelial cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased cell proliferation in the cornea without an increase in corneal thickness and increased microvessel branching in the middle levels of the retina. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029H14Rik T C 8: 13,551,842 probably benign Het
2210010C04Rik T C 6: 41,034,347 N34D probably benign Het
5730507C01Rik A T 12: 18,533,423 R161S possibly damaging Het
Adamts5 T C 16: 85,866,642 I735V probably benign Het
Arid1a G T 4: 133,681,124 P2024Q unknown Het
Ascc3 G T 10: 50,748,926 V1637L probably benign Het
B3galt4 T C 17: 33,950,790 Y158C probably damaging Het
BC049715 A G 6: 136,840,145 T128A possibly damaging Het
Btaf1 T A 19: 36,945,229 I11N probably damaging Het
Cfb T C 17: 34,858,509 I496V probably damaging Het
Chd8 A T 14: 52,204,060 H858Q probably benign Het
Chrne T C 11: 70,615,723 I324V probably benign Het
Clec14a T C 12: 58,267,665 I390M probably damaging Het
Cpsf3 A G 12: 21,297,799 Y207C probably damaging Het
Cubn A C 2: 13,469,763 I410S possibly damaging Het
Cubn T A 2: 13,469,764 I410F possibly damaging Het
Dlc1 T C 8: 36,583,586 E997G possibly damaging Het
Emilin1 G T 5: 30,915,022 V71F probably damaging Het
Esrp2 T C 8: 106,134,675 E164G probably damaging Het
Fars2 A G 13: 36,537,311 T410A probably benign Het
Fat3 A G 9: 15,992,256 V2981A probably damaging Het
Fkbp15 G A 4: 62,326,136 T472I probably benign Het
Gm6871 A G 7: 41,573,445 V73A probably benign Het
Gnl2 T G 4: 125,053,527 S647R probably benign Het
Grb10 T C 11: 11,934,207 I500V possibly damaging Het
Herc1 T C 9: 66,446,074 probably benign Het
Iqgap2 A C 13: 95,689,699 probably null Het
Kcnu1 A T 8: 25,937,618 N321I probably benign Het
Kif23 G A 9: 61,926,405 R519* probably null Het
Klhl1 C T 14: 96,381,789 R224Q probably benign Het
Lama1 T C 17: 67,791,610 probably null Het
Lamp3 T C 16: 19,673,552 Y314C probably damaging Het
Lamtor5 C A 3: 107,281,911 R88S probably damaging Het
Nbea G T 3: 55,819,294 A2088E probably benign Het
Neo1 A G 9: 58,990,180 probably benign Het
Olfr1020 A T 2: 85,849,967 R172* probably null Het
Plekho2 A G 9: 65,557,052 S172P possibly damaging Het
Pmp2 T C 3: 10,180,763 Y129C probably damaging Het
Ralgapa2 A T 2: 146,428,672 M578K possibly damaging Het
Ranbp3 C T 17: 56,708,219 T307M possibly damaging Het
Serpinb11 G A 1: 107,376,860 W185* probably null Het
Setdb2 A T 14: 59,406,744 probably null Het
Sirpb1b A T 3: 15,548,596 V75E probably damaging Het
Slc13a1 A T 6: 24,100,293 L397Q probably damaging Het
Slc19a1 T A 10: 77,042,908 I355N probably damaging Het
Slc51a T A 16: 32,476,436 I275F possibly damaging Het
Spink14 T C 18: 44,031,867 S84P probably damaging Het
Stx2 A G 5: 128,993,577 probably benign Het
Tgfbi G T 13: 56,632,193 probably benign Het
Tshr T A 12: 91,537,869 M527K probably damaging Het
Upb1 T C 10: 75,412,883 V79A probably damaging Het
Zdhhc5 A T 2: 84,691,243 probably null Het
Zfp11 C T 5: 129,658,238 G53E possibly damaging Het
Zfp280d T C 9: 72,312,237 V32A probably benign Het
Other mutations in Ntn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02052:Ntn4 APN 10 93707349 missense probably damaging 1.00
IGL02212:Ntn4 APN 10 93644849 missense possibly damaging 0.50
IGL02698:Ntn4 APN 10 93644659 missense probably benign 0.19
IGL02752:Ntn4 APN 10 93710559 missense possibly damaging 0.84
PIT4468001:Ntn4 UTSW 10 93644725 missense probably damaging 0.99
R0131:Ntn4 UTSW 10 93644707 missense possibly damaging 0.89
R0131:Ntn4 UTSW 10 93644707 missense possibly damaging 0.89
R0132:Ntn4 UTSW 10 93644707 missense possibly damaging 0.89
R1304:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1306:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1307:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1308:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1619:Ntn4 UTSW 10 93644734 missense probably damaging 1.00
R1645:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1664:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1695:Ntn4 UTSW 10 93733602 splice site probably null
R1796:Ntn4 UTSW 10 93745771 missense probably damaging 1.00
R1806:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1845:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1856:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1872:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1879:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1901:Ntn4 UTSW 10 93707372 missense possibly damaging 0.93
R1902:Ntn4 UTSW 10 93707372 missense possibly damaging 0.93
R1925:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1926:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1927:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R2060:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R2113:Ntn4 UTSW 10 93644839 missense probably damaging 1.00
R2202:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R2203:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R2975:Ntn4 UTSW 10 93644891 missense probably damaging 1.00
R4277:Ntn4 UTSW 10 93741210 missense possibly damaging 0.95
R4805:Ntn4 UTSW 10 93644500 missense probably damaging 0.99
R4806:Ntn4 UTSW 10 93644500 missense probably damaging 0.99
R4807:Ntn4 UTSW 10 93644500 missense probably damaging 0.99
R5818:Ntn4 UTSW 10 93644764 missense probably benign 0.40
R6048:Ntn4 UTSW 10 93707266 splice site probably null
R6051:Ntn4 UTSW 10 93745795 missense probably benign
R6346:Ntn4 UTSW 10 93644861 missense probably damaging 1.00
R6752:Ntn4 UTSW 10 93734175 missense probably benign
R7196:Ntn4 UTSW 10 93733714 missense probably benign 0.01
R7240:Ntn4 UTSW 10 93745741 missense probably damaging 0.99
R7365:Ntn4 UTSW 10 93644804 missense probably damaging 1.00
R7374:Ntn4 UTSW 10 93682572 missense probably benign
R7505:Ntn4 UTSW 10 93707284 missense probably damaging 1.00
R7509:Ntn4 UTSW 10 93710568 missense probably benign 0.01
R7726:Ntn4 UTSW 10 93733682 missense possibly damaging 0.82
R7957:Ntn4 UTSW 10 93644473 splice site probably benign
R8092:Ntn4 UTSW 10 93741056 missense probably damaging 0.97
R8202:Ntn4 UTSW 10 93644903 missense possibly damaging 0.88
R8508:Ntn4 UTSW 10 93741104 missense possibly damaging 0.48
R9010:Ntn4 UTSW 10 93644644 missense
R9115:Ntn4 UTSW 10 93733813 missense probably benign
R9415:Ntn4 UTSW 10 93644626 missense probably benign 0.00
RF045:Ntn4 UTSW 10 93710625 missense possibly damaging 0.95
X0024:Ntn4 UTSW 10 93644971 missense probably damaging 1.00
Z1176:Ntn4 UTSW 10 93741153 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTTGTACACCATTCCCATCTGGAC -3'
(R):5'- GCTGCCCTTGACGATGAAGTCATAG -3'

Sequencing Primer
(F):5'- AATAACAGGGTGGCCCTTCTC -3'
(R):5'- CTTGACGATGAAGTCATAGACTGC -3'
Posted On 2013-05-09