Mutagenetix > Incidental Mutation

Incidental Mutation 'R0419:Ntn4'

36937

Institutional Source

Beutler Lab

Gene Symbol

Ntn4

Ensembl Gene

ENSMUSG00000020019

Gene Name

netrin 4

Synonyms

beta-netrin

MMRRC Submission

038621-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0419 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

93640681-93747207 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 93682429 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Serine at position 199 (R199S)

Ref Sequence

ENSEMBL: ENSMUSP00000020204 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020204]

AlphaFold

Q9JI33

Predicted Effect

probably benign
Transcript: ENSMUST00000020204
AA Change: R199S

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000020204
Gene: ENSMUSG00000020019
AA Change: R199S

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
LamNT	28	260	6.48e-55	SMART
EGF_Lam	262	329	5.83e-7	SMART
EGF_Lam	332	392	3.32e-11	SMART
EGF_Lam	395	446	3.73e-14	SMART
C345C	516	625	5.58e-25	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147379

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.8%

Validation Efficiency

98% (54/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the netrin family of proteins, which function in various biological processes including axon guidance, tumorogenesis, and angiogenesis. Netrins are laminin-related proteins that have an N-terminal laminin-type domain, epidermal growth factor-like repeat domain, and a positively charged heparin-binding domain at the C-terminus. The protein encoded by this gene is involved in processes including neurite growth and migration, angiogenesis and mural cell adhesion to endothelial cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased cell proliferation in the cornea without an increase in corneal thickness and increased microvessel branching in the middle levels of the retina. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700029H14Rik	T	C	8: 13,551,842		probably benign	Het
2210010C04Rik	T	C	6: 41,034,347	N34D	probably benign	Het
5730507C01Rik	A	T	12: 18,533,423	R161S	possibly damaging	Het
Adamts5	T	C	16: 85,866,642	I735V	probably benign	Het
Arid1a	G	T	4: 133,681,124	P2024Q	unknown	Het
Ascc3	G	T	10: 50,748,926	V1637L	probably benign	Het
B3galt4	T	C	17: 33,950,790	Y158C	probably damaging	Het
BC049715	A	G	6: 136,840,145	T128A	possibly damaging	Het
Btaf1	T	A	19: 36,945,229	I11N	probably damaging	Het
Cfb	T	C	17: 34,858,509	I496V	probably damaging	Het
Chd8	A	T	14: 52,204,060	H858Q	probably benign	Het
Chrne	T	C	11: 70,615,723	I324V	probably benign	Het
Clec14a	T	C	12: 58,267,665	I390M	probably damaging	Het
Cpsf3	A	G	12: 21,297,799	Y207C	probably damaging	Het
Cubn	A	C	2: 13,469,763	I410S	possibly damaging	Het
Cubn	T	A	2: 13,469,764	I410F	possibly damaging	Het
Dlc1	T	C	8: 36,583,586	E997G	possibly damaging	Het
Emilin1	G	T	5: 30,915,022	V71F	probably damaging	Het
Esrp2	T	C	8: 106,134,675	E164G	probably damaging	Het
Fars2	A	G	13: 36,537,311	T410A	probably benign	Het
Fat3	A	G	9: 15,992,256	V2981A	probably damaging	Het
Fkbp15	G	A	4: 62,326,136	T472I	probably benign	Het
Gm6871	A	G	7: 41,573,445	V73A	probably benign	Het
Gnl2	T	G	4: 125,053,527	S647R	probably benign	Het
Grb10	T	C	11: 11,934,207	I500V	possibly damaging	Het
Herc1	T	C	9: 66,446,074		probably benign	Het
Iqgap2	A	C	13: 95,689,699		probably null	Het
Kcnu1	A	T	8: 25,937,618	N321I	probably benign	Het
Kif23	G	A	9: 61,926,405	R519*	probably null	Het
Klhl1	C	T	14: 96,381,789	R224Q	probably benign	Het
Lama1	T	C	17: 67,791,610		probably null	Het
Lamp3	T	C	16: 19,673,552	Y314C	probably damaging	Het
Lamtor5	C	A	3: 107,281,911	R88S	probably damaging	Het
Nbea	G	T	3: 55,819,294	A2088E	probably benign	Het
Neo1	A	G	9: 58,990,180		probably benign	Het
Olfr1020	A	T	2: 85,849,967	R172*	probably null	Het
Plekho2	A	G	9: 65,557,052	S172P	possibly damaging	Het
Pmp2	T	C	3: 10,180,763	Y129C	probably damaging	Het
Ralgapa2	A	T	2: 146,428,672	M578K	possibly damaging	Het
Ranbp3	C	T	17: 56,708,219	T307M	possibly damaging	Het
Serpinb11	G	A	1: 107,376,860	W185*	probably null	Het
Setdb2	A	T	14: 59,406,744		probably null	Het
Sirpb1b	A	T	3: 15,548,596	V75E	probably damaging	Het
Slc13a1	A	T	6: 24,100,293	L397Q	probably damaging	Het
Slc19a1	T	A	10: 77,042,908	I355N	probably damaging	Het
Slc51a	T	A	16: 32,476,436	I275F	possibly damaging	Het
Spink14	T	C	18: 44,031,867	S84P	probably damaging	Het
Stx2	A	G	5: 128,993,577		probably benign	Het
Tgfbi	G	T	13: 56,632,193		probably benign	Het
Tshr	T	A	12: 91,537,869	M527K	probably damaging	Het
Upb1	T	C	10: 75,412,883	V79A	probably damaging	Het
Zdhhc5	A	T	2: 84,691,243		probably null	Het
Zfp11	C	T	5: 129,658,238	G53E	possibly damaging	Het
Zfp280d	T	C	9: 72,312,237	V32A	probably benign	Het

Other mutations in Ntn4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02052:Ntn4	APN	10	93707349	missense	probably damaging	1.00
IGL02212:Ntn4	APN	10	93644849	missense	possibly damaging	0.50
IGL02698:Ntn4	APN	10	93644659	missense	probably benign	0.19
IGL02752:Ntn4	APN	10	93710559	missense	possibly damaging	0.84
PIT4468001:Ntn4	UTSW	10	93644725	missense	probably damaging	0.99
R0131:Ntn4	UTSW	10	93644707	missense	possibly damaging	0.89
R0131:Ntn4	UTSW	10	93644707	missense	possibly damaging	0.89
R0132:Ntn4	UTSW	10	93644707	missense	possibly damaging	0.89
R1304:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1306:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1307:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1308:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1619:Ntn4	UTSW	10	93644734	missense	probably damaging	1.00
R1645:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1664:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1695:Ntn4	UTSW	10	93733602	splice site	probably null
R1796:Ntn4	UTSW	10	93745771	missense	probably damaging	1.00
R1806:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1845:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1856:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1872:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1879:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1901:Ntn4	UTSW	10	93707372	missense	possibly damaging	0.93
R1902:Ntn4	UTSW	10	93707372	missense	possibly damaging	0.93
R1925:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1926:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1927:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R2060:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R2113:Ntn4	UTSW	10	93644839	missense	probably damaging	1.00
R2202:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R2203:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R2975:Ntn4	UTSW	10	93644891	missense	probably damaging	1.00
R4277:Ntn4	UTSW	10	93741210	missense	possibly damaging	0.95
R4805:Ntn4	UTSW	10	93644500	missense	probably damaging	0.99
R4806:Ntn4	UTSW	10	93644500	missense	probably damaging	0.99
R4807:Ntn4	UTSW	10	93644500	missense	probably damaging	0.99
R5818:Ntn4	UTSW	10	93644764	missense	probably benign	0.40
R6048:Ntn4	UTSW	10	93707266	splice site	probably null
R6051:Ntn4	UTSW	10	93745795	missense	probably benign
R6346:Ntn4	UTSW	10	93644861	missense	probably damaging	1.00
R6752:Ntn4	UTSW	10	93734175	missense	probably benign
R7196:Ntn4	UTSW	10	93733714	missense	probably benign	0.01
R7240:Ntn4	UTSW	10	93745741	missense	probably damaging	0.99
R7365:Ntn4	UTSW	10	93644804	missense	probably damaging	1.00
R7374:Ntn4	UTSW	10	93682572	missense	probably benign
R7505:Ntn4	UTSW	10	93707284	missense	probably damaging	1.00
R7509:Ntn4	UTSW	10	93710568	missense	probably benign	0.01
R7726:Ntn4	UTSW	10	93733682	missense	possibly damaging	0.82
R7957:Ntn4	UTSW	10	93644473	splice site	probably benign
R8092:Ntn4	UTSW	10	93741056	missense	probably damaging	0.97
R8202:Ntn4	UTSW	10	93644903	missense	possibly damaging	0.88
R8508:Ntn4	UTSW	10	93741104	missense	possibly damaging	0.48
R9010:Ntn4	UTSW	10	93644644	missense
R9115:Ntn4	UTSW	10	93733813	missense	probably benign
R9415:Ntn4	UTSW	10	93644626	missense	probably benign	0.00
RF045:Ntn4	UTSW	10	93710625	missense	possibly damaging	0.95
X0024:Ntn4	UTSW	10	93644971	missense	probably damaging	1.00
Z1176:Ntn4	UTSW	10	93741153	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGTTGTACACCATTCCCATCTGGAC -3'
(R):5'- GCTGCCCTTGACGATGAAGTCATAG -3'

Sequencing Primer
(F):5'- AATAACAGGGTGGCCCTTCTC -3'
(R):5'- CTTGACGATGAAGTCATAGACTGC -3'

Posted On

2013-05-09