Mutagenetix > Incidental Mutation

Incidental Mutation 'R4811:Erbb4'

369400

Institutional Source

Beutler Lab

Gene Symbol

Erbb4

Ensembl Gene

ENSMUSG00000062209

Gene Name

erb-b2 receptor tyrosine kinase 4

Synonyms

Her4, ErbB4

MMRRC Submission

042430-MU

Accession Numbers

Ncbi RefSeq: NM_010154.1; MGI:104771

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4811 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

68032186-69108059 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 68254544 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 729 (F729L)

Ref Sequence

ENSEMBL: ENSMUSP00000114123 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000119142] [ENSMUST00000121473] [ENSMUST00000153432]

AlphaFold

Q61527

Predicted Effect

probably damaging
Transcript: ENSMUST00000119142
AA Change: F729L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000112713
Gene: ENSMUSG00000062209
AA Change: F729L

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:Recep_L_domain	55	167	5e-34	PFAM
FU	183	223	2.07e1	SMART
FU	226	268	5.78e-10	SMART
Pfam:Recep_L_domain	358	478	1e-29	PFAM
FU	493	544	6.45e-8	SMART
FU	549	599	3.51e-9	SMART
FU	611	659	2.32e0	SMART
TyrKc	718	974	7.53e-133	SMART
low complexity region	1007	1023	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000121473
AA Change: F729L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000114123
Gene: ENSMUSG00000062209
AA Change: F729L

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:Recep_L_domain	55	167	1.6e-34	PFAM
FU	183	223	2.07e1	SMART
FU	226	268	5.78e-10	SMART
Pfam:Recep_L_domain	358	478	5.5e-29	PFAM
FU	493	544	6.45e-8	SMART
FU	549	599	3.51e-9	SMART
FU	611	659	2.32e0	SMART
TyrKc	718	974	7.53e-133	SMART
low complexity region	1007	1023	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000153432
AA Change: F719L

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000115373
Gene: ENSMUSG00000062209
AA Change: F719L

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:Recep_L_domain	55	167	1.7e-34	PFAM
FU	183	223	2.07e1	SMART
FU	226	268	5.78e-10	SMART
Pfam:Recep_L_domain	358	478	5.7e-29	PFAM
FU	493	544	6.45e-8	SMART
FU	549	599	3.51e-9	SMART
FU	611	649	2.98e0	SMART
PDB:2R4B\|B	680	732	1e-25	PDB

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 93.0%

Validation Efficiency

MGI Phenotype

Strain: 1929607
Lethality: E10-E11
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Tyr protein kinase family and the epidermal growth factor receptor subfamily. It encodes a single-pass type I membrane protein with multiple cysteine rich domains, a transmembrane domain, a tyrosine kinase domain, a phosphotidylinositol-3 kinase binding site and a PDZ domain binding motif. The protein binds to and is activated by neuregulins and other factors and induces a variety of cellular responses including mitogenesis and differentiation. Multiple proteolytic events allow for the release of a cytoplasmic fragment and an extracellular fragment. Mutations in this gene have been associated with cancer. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit cardiac defects, alterations in hindbrain development, and midgestational lethality. Heterozygotes show schizophrenia-like behavior. Genetically rescued females show mammary defects. [provided by MGI curators]

Allele List at MGI

All alleles(7) : Targeted(6) Gene trapped(1)

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930447A16Rik	G	A	15: 37,425,708		probably benign	Het
Adam3	C	T	8: 24,711,724	G208R	probably benign	Het
AI481877	T	C	4: 59,082,404	N408S	probably benign	Het
Arsg	G	T	11: 109,534,072	V290L	probably benign	Het
Cad	A	G	5: 31,074,690	T104A	probably benign	Het
Ccdc180	A	G	4: 45,928,020	N1185S	probably damaging	Het
Cdh18	A	G	15: 23,226,791	T113A	probably benign	Het
Crocc2	G	A	1: 93,205,896	A967T	probably damaging	Het
Cyp4f16	A	G	17: 32,545,106	T291A	probably benign	Het
Dcc	T	A	18: 71,299,483	H1300L	probably benign	Het
Ddx23	T	A	15: 98,647,471		probably null	Het
Dnhd1	T	G	7: 105,714,281	S4017A	probably damaging	Het
Ercc6	G	T	14: 32,574,929	R1292L	probably benign	Het
Fam186b	C	T	15: 99,280,237	V403M	probably benign	Het
Fam227a	T	C	15: 79,615,427	N576D	possibly damaging	Het
Fam46b	T	C	4: 133,486,370	L184P	probably benign	Het
Fbln1	A	G	15: 85,226,966		probably null	Het
Fbxw17	T	C	13: 50,425,633	V162A	probably benign	Het
Gas2l1	A	C	11: 5,064,436	I8S	probably damaging	Het
Gm7030	A	G	17: 36,127,776	L241S	probably damaging	Het
Golgb1	T	C	16: 36,891,419	L195P	probably damaging	Het
Gps2	A	T	11: 69,915,928	H233L	probably damaging	Het
Guf1	T	G	5: 69,564,509		probably null	Het
Il1rap	T	A	16: 26,701,238		probably null	Het
Ints14	A	G	9: 64,964,518	Y46C	probably damaging	Het
Kalrn	T	G	16: 34,356,969	Q293H	probably damaging	Het
Kank2	A	G	9: 21,775,747	L593P	probably damaging	Het
Krt19	T	C	11: 100,141,348	T297A	possibly damaging	Het
Lcp1	T	C	14: 75,200,408	V86A	probably damaging	Het
Lins1	T	A	7: 66,708,150	I11K	probably benign	Het
Lrba	T	C	3: 86,776,141	F2757L	probably damaging	Het
Lyst	T	C	13: 13,777,100	I3762T	probably benign	Het
Lyzl6	A	G	11: 103,635,025	S90P	possibly damaging	Het
Mfsd2a	T	A	4: 122,959,382	Q38L	probably benign	Het
Mtss1	A	G	15: 58,944,073	F546S	probably damaging	Het
Myo5a	G	A	9: 75,141,543		probably null	Het
Naip6	C	A	13: 100,285,791	G1245W	probably damaging	Het
Ndfip1	C	T	18: 38,451,592	T107I	probably benign	Het
Nek8	C	T	11: 78,167,718		probably null	Het
Nphs1	T	C	7: 30,460,429	V55A	probably damaging	Het
Nrp2	C	A	1: 62,719,081	H75Q	probably damaging	Het
Oas1e	C	T	5: 120,795,383	S39N	probably damaging	Het
Olfr1164	A	G	2: 88,093,532	F135L	probably benign	Het
Olfr1391	T	G	11: 49,327,748	S112R	possibly damaging	Het
Olfr309	T	C	7: 86,306,958	T52A	probably benign	Het
Olfr871	A	T	9: 20,212,753	I135F	probably damaging	Het
Pan3	T	A	5: 147,530,058	H632Q	probably damaging	Het
Paqr3	A	C	5: 97,095,983	S291A	probably benign	Het
Pcdh17	A	C	14: 84,447,935	D614A	probably damaging	Het
Pcyox1l	T	C	18: 61,697,535	E422G	possibly damaging	Het
Pgr	G	T	9: 8,900,843	E126*	probably null	Het
Pik3ap1	A	G	19: 41,302,497	V532A	possibly damaging	Het
Pla2g4c	T	C	7: 13,337,813	I186T	probably damaging	Het
Pnkd	G	A	1: 74,349,405		probably null	Het
Poc1a	A	G	9: 106,349,709	T334A	probably damaging	Het
Pou2f2	T	A	7: 25,097,686	K211*	probably null	Het
Rdh13	T	C	7: 4,442,653	E94G	probably benign	Het
Rnf186	A	G	4: 138,967,187	S13G	probably benign	Het
Ryr2	T	C	13: 11,655,698	R3471G	probably damaging	Het
Sbf2	T	C	7: 110,372,535	T831A	probably damaging	Het
Sh3gl2	A	G	4: 85,398,166		probably benign	Het
Snn	T	C	16: 11,072,533	V72A	probably benign	Het
Sys1	T	A	2: 164,464,424	H99Q	possibly damaging	Het
Syt7	A	G	19: 10,435,567	K122R	probably damaging	Het
Tas1r2	T	A	4: 139,669,000	L550Q	probably damaging	Het
Thoc1	T	C	18: 9,993,438	I599T	probably damaging	Het
Tle3	C	T	9: 61,373,997		probably benign	Het
Tll1	A	C	8: 64,085,473	V379G	possibly damaging	Het
Tnfrsf21	G	A	17: 43,037,730	E78K	probably benign	Het
Tpgs2	A	G	18: 25,129,840		probably benign	Het
Trpm1	T	C	7: 64,208,306	L165P	probably damaging	Het
Trpm5	T	C	7: 143,080,219	Y750C	probably damaging	Het
Ttbk2	A	C	2: 120,740,070	S1201A	possibly damaging	Het
Ust	T	A	10: 8,245,941	H301L	probably damaging	Het
Vwa5a	T	C	9: 38,735,953	F543L	probably benign	Het
Yeats2	T	A	16: 20,152,895		probably null	Het
Zfp85	T	C	13: 67,749,626	Y109C	probably damaging	Het
Zfr2	T	A	10: 81,243,713	V362E	probably benign	Het
Znrf3	A	T	11: 5,287,420	C134S	probably benign	Het

Other mutations in Erbb4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00965:Erbb4	APN	1	68071630	nonsense	probably null
IGL01020:Erbb4	APN	1	68298449	splice site	probably benign
IGL01349:Erbb4	APN	1	68346593	missense	probably benign	0.00
IGL01386:Erbb4	APN	1	68343931	missense	probably damaging	1.00
IGL01516:Erbb4	APN	1	68328245	nonsense	probably null
IGL01536:Erbb4	APN	1	68290282	missense	probably benign	0.00
IGL01721:Erbb4	APN	1	68254563	missense	possibly damaging	0.46
IGL01832:Erbb4	APN	1	68254566	missense	possibly damaging	0.84
IGL02002:Erbb4	APN	1	68080726	missense	probably damaging	1.00
IGL02040:Erbb4	APN	1	68042535	missense	probably damaging	1.00
IGL02371:Erbb4	APN	1	68290294	missense	probably benign	0.00
IGL02399:Erbb4	APN	1	68042437	splice site	probably benign
IGL02553:Erbb4	APN	1	68305864	missense	probably benign	0.17
IGL03118:Erbb4	APN	1	68042719	missense	probably benign	0.11
IGL03329:Erbb4	APN	1	68328122	missense	probably benign	0.30
IGL03405:Erbb4	APN	1	68330238	missense	probably benign	0.02
earthworm	UTSW	1	68250580	missense	possibly damaging	0.67
excrescence	UTSW	1	68330246	missense	probably damaging	1.00
Mole	UTSW	1	68560576	missense	probably damaging	1.00
P0018:Erbb4	UTSW	1	68071676	missense	probably benign	0.05
PIT4480001:Erbb4	UTSW	1	68075543	missense	probably damaging	1.00
R0193:Erbb4	UTSW	1	68043960	intron	probably benign
R0329:Erbb4	UTSW	1	68298280	splice site	probably benign
R0335:Erbb4	UTSW	1	68259259	missense	probably benign
R0362:Erbb4	UTSW	1	68330270	missense	probably damaging	0.99
R0579:Erbb4	UTSW	1	68042462	missense	probably benign	0.17
R0730:Erbb4	UTSW	1	68259290	missense	probably damaging	0.98
R1029:Erbb4	UTSW	1	68309614	missense	probably damaging	0.96
R1444:Erbb4	UTSW	1	68254600	missense	probably damaging	1.00
R1469:Erbb4	UTSW	1	68560682	missense	probably damaging	0.99
R1469:Erbb4	UTSW	1	68560682	missense	probably damaging	0.99
R1503:Erbb4	UTSW	1	68346546	missense	probably benign	0.00
R1523:Erbb4	UTSW	1	68396252	missense	possibly damaging	0.95
R1528:Erbb4	UTSW	1	68078582	nonsense	probably null
R1604:Erbb4	UTSW	1	68346569	missense	possibly damaging	0.88
R1611:Erbb4	UTSW	1	68040388	missense	probably damaging	1.00
R1642:Erbb4	UTSW	1	68331234	missense	probably damaging	1.00
R1905:Erbb4	UTSW	1	68075410	splice site	probably benign
R1929:Erbb4	UTSW	1	68198888	missense	probably damaging	0.98
R2046:Erbb4	UTSW	1	68298323	missense	probably benign	0.02
R2139:Erbb4	UTSW	1	68346629	missense	probably damaging	0.96
R2271:Erbb4	UTSW	1	68198888	missense	probably damaging	0.98
R2298:Erbb4	UTSW	1	68042531	missense	probably damaging	1.00
R2356:Erbb4	UTSW	1	68078596	missense	probably benign	0.00
R3821:Erbb4	UTSW	1	68305913	missense	probably damaging	0.97
R4007:Erbb4	UTSW	1	68740401	missense	probably damaging	1.00
R4012:Erbb4	UTSW	1	68560576	missense	probably damaging	1.00
R4077:Erbb4	UTSW	1	68040337	missense	probably benign	0.07
R4196:Erbb4	UTSW	1	68343855	missense	possibly damaging	0.90
R4536:Erbb4	UTSW	1	68346622	missense	probably damaging	1.00
R4561:Erbb4	UTSW	1	68343921	nonsense	probably null
R4642:Erbb4	UTSW	1	68250632	missense	probably damaging	1.00
R4737:Erbb4	UTSW	1	68343900	missense	probably damaging	0.98
R4739:Erbb4	UTSW	1	68343900	missense	probably damaging	0.98
R4780:Erbb4	UTSW	1	68298314	missense	probably damaging	1.00
R4801:Erbb4	UTSW	1	68330246	missense	probably damaging	1.00
R4802:Erbb4	UTSW	1	68330246	missense	probably damaging	1.00
R4832:Erbb4	UTSW	1	68330238	missense	probably benign	0.02
R5068:Erbb4	UTSW	1	68043902	splice site	probably null
R5546:Erbb4	UTSW	1	68298293	missense	probably damaging	0.99
R5755:Erbb4	UTSW	1	68560519	missense	possibly damaging	0.96
R6189:Erbb4	UTSW	1	68043916	missense	probably benign
R6257:Erbb4	UTSW	1	68396273	missense	probably damaging	1.00
R6276:Erbb4	UTSW	1	68560576	missense	probably damaging	1.00
R6521:Erbb4	UTSW	1	68042530	missense	probably damaging	1.00
R6602:Erbb4	UTSW	1	68370503	missense	probably damaging	0.99
R6808:Erbb4	UTSW	1	68040303	missense	probably benign	0.00
R7087:Erbb4	UTSW	1	68740491	missense	probably null	1.00
R7215:Erbb4	UTSW	1	68339460	missense	probably benign
R7356:Erbb4	UTSW	1	68339355	critical splice donor site	probably null
R7509:Erbb4	UTSW	1	68250580	missense	possibly damaging	0.67
R7593:Erbb4	UTSW	1	68254599	missense	probably damaging	0.99
R7743:Erbb4	UTSW	1	68328119	missense	probably benign	0.00
R7784:Erbb4	UTSW	1	68075499	missense	probably damaging	1.00
R7815:Erbb4	UTSW	1	68042726	missense	probably damaging	1.00
R7923:Erbb4	UTSW	1	68259209	missense	probably damaging	1.00
R8071:Erbb4	UTSW	1	68396311	missense	probably damaging	1.00
R8288:Erbb4	UTSW	1	68298350	missense	probably damaging	1.00
R8356:Erbb4	UTSW	1	68071630	missense	probably damaging	1.00
R8456:Erbb4	UTSW	1	68071630	missense	probably damaging	1.00
R8464:Erbb4	UTSW	1	68309626	missense	probably benign
R8783:Erbb4	UTSW	1	68040172	missense	possibly damaging	0.95
R8830:Erbb4	UTSW	1	68075468	missense	probably damaging	1.00
R8881:Erbb4	UTSW	1	68343838	critical splice donor site	probably null
R9053:Erbb4	UTSW	1	68250620	missense	possibly damaging	0.63
R9142:Erbb4	UTSW	1	68349393	missense	probably damaging	1.00
R9237:Erbb4	UTSW	1	68042442	missense	possibly damaging	0.72
R9350:Erbb4	UTSW	1	68290479	missense	probably benign	0.00
R9374:Erbb4	UTSW	1	68740483	nonsense	probably null
R9434:Erbb4	UTSW	1	68042614	missense	possibly damaging	0.84
R9499:Erbb4	UTSW	1	68740483	nonsense	probably null
R9551:Erbb4	UTSW	1	68740483	nonsense	probably null
X0019:Erbb4	UTSW	1	68073145	missense	probably benign	0.00
Z1176:Erbb4	UTSW	1	68298402	frame shift	probably null
Z1176:Erbb4	UTSW	1	68328259	nonsense	probably null
Z1177:Erbb4	UTSW	1	68259183	frame shift	probably null
Z1177:Erbb4	UTSW	1	68290476	missense	probably damaging	1.00
Z1177:Erbb4	UTSW	1	68309643	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- AGCAACTTCTCAGCACTACTAAGG -3'
(R):5'- ATGTATGCTGGCGTACTCTTC -3'

Sequencing Primer
(F):5'- TTATGGAGCAGAGAACTACCTCGTC -3'
(R):5'- GTATGCTGGCGTACTCTTCTAAAAGC -3'

Posted On

2016-02-04