Incidental Mutation 'R4811:Ccdc180'
ID369408
Institutional Source Beutler Lab
Gene Symbol Ccdc180
Ensembl Gene ENSMUSG00000035539
Gene Namecoiled-coil domain containing 180
SynonymsE230008N13Rik, LOC381522
MMRRC Submission 042430-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4811 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location45890303-45950774 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45928020 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 1185 (N1185S)
Ref Sequence ENSEMBL: ENSMUSP00000136714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178561]
Predicted Effect unknown
Transcript: ENSMUST00000149903
AA Change: N1009S
SMART Domains Protein: ENSMUSP00000119784
Gene: ENSMUSG00000035539
AA Change: N1009S

DomainStartEndE-ValueType
low complexity region 25 42 N/A INTRINSIC
coiled coil region 90 117 N/A INTRINSIC
Pfam:DUF4455 141 609 2e-189 PFAM
low complexity region 628 642 N/A INTRINSIC
low complexity region 658 675 N/A INTRINSIC
coiled coil region 710 780 N/A INTRINSIC
coiled coil region 945 979 N/A INTRINSIC
low complexity region 1100 1123 N/A INTRINSIC
Pfam:DUF4456 1169 1372 9.5e-77 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000178561
AA Change: N1185S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000136714
Gene: ENSMUSG00000035539
AA Change: N1185S

DomainStartEndE-ValueType
low complexity region 32 49 N/A INTRINSIC
coiled coil region 98 125 N/A INTRINSIC
Pfam:DUF4455 148 616 7.3e-189 PFAM
low complexity region 635 649 N/A INTRINSIC
low complexity region 665 682 N/A INTRINSIC
coiled coil region 718 788 N/A INTRINSIC
coiled coil region 1121 1155 N/A INTRINSIC
low complexity region 1275 1298 N/A INTRINSIC
Pfam:DUF4456 1344 1547 2.2e-76 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a coiled-coil domain. Alternative splicing results in multiple transcript variants encoding different isoforms. A single nucleotide polymorphism (SNP) in this gene has been associated with increased susceptibility to Behcet's Disease (PMID: 19442274). [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447A16Rik G A 15: 37,425,708 probably benign Het
Adam3 C T 8: 24,711,724 G208R probably benign Het
AI481877 T C 4: 59,082,404 N408S probably benign Het
Arsg G T 11: 109,534,072 V290L probably benign Het
Cad A G 5: 31,074,690 T104A probably benign Het
Cdh18 A G 15: 23,226,791 T113A probably benign Het
Crocc2 G A 1: 93,205,896 A967T probably damaging Het
Cyp4f16 A G 17: 32,545,106 T291A probably benign Het
Dcc T A 18: 71,299,483 H1300L probably benign Het
Ddx23 T A 15: 98,647,471 probably null Het
Dnhd1 T G 7: 105,714,281 S4017A probably damaging Het
Erbb4 A T 1: 68,254,544 F729L probably damaging Het
Ercc6 G T 14: 32,574,929 R1292L probably benign Het
Fam186b C T 15: 99,280,237 V403M probably benign Het
Fam227a T C 15: 79,615,427 N576D possibly damaging Het
Fam46b T C 4: 133,486,370 L184P probably benign Het
Fbln1 A G 15: 85,226,966 probably null Het
Fbxw17 T C 13: 50,425,633 V162A probably benign Het
Gas2l1 A C 11: 5,064,436 I8S probably damaging Het
Gm7030 A G 17: 36,127,776 L241S probably damaging Het
Golgb1 T C 16: 36,891,419 L195P probably damaging Het
Gps2 A T 11: 69,915,928 H233L probably damaging Het
Guf1 T G 5: 69,564,509 probably null Het
Il1rap T A 16: 26,701,238 probably null Het
Ints14 A G 9: 64,964,518 Y46C probably damaging Het
Kalrn T G 16: 34,356,969 Q293H probably damaging Het
Kank2 A G 9: 21,775,747 L593P probably damaging Het
Krt19 T C 11: 100,141,348 T297A possibly damaging Het
Lcp1 T C 14: 75,200,408 V86A probably damaging Het
Lins1 T A 7: 66,708,150 I11K probably benign Het
Lrba T C 3: 86,776,141 F2757L probably damaging Het
Lyst T C 13: 13,777,100 I3762T probably benign Het
Lyzl6 A G 11: 103,635,025 S90P possibly damaging Het
Mfsd2a T A 4: 122,959,382 Q38L probably benign Het
Mtss1 A G 15: 58,944,073 F546S probably damaging Het
Myo5a G A 9: 75,141,543 probably null Het
Naip6 C A 13: 100,285,791 G1245W probably damaging Het
Ndfip1 C T 18: 38,451,592 T107I probably benign Het
Nek8 C T 11: 78,167,718 probably null Het
Nphs1 T C 7: 30,460,429 V55A probably damaging Het
Nrp2 C A 1: 62,719,081 H75Q probably damaging Het
Oas1e C T 5: 120,795,383 S39N probably damaging Het
Olfr1164 A G 2: 88,093,532 F135L probably benign Het
Olfr1391 T G 11: 49,327,748 S112R possibly damaging Het
Olfr309 T C 7: 86,306,958 T52A probably benign Het
Olfr871 A T 9: 20,212,753 I135F probably damaging Het
Pan3 T A 5: 147,530,058 H632Q probably damaging Het
Paqr3 A C 5: 97,095,983 S291A probably benign Het
Pcdh17 A C 14: 84,447,935 D614A probably damaging Het
Pcyox1l T C 18: 61,697,535 E422G possibly damaging Het
Pgr G T 9: 8,900,843 E126* probably null Het
Pik3ap1 A G 19: 41,302,497 V532A possibly damaging Het
Pla2g4c T C 7: 13,337,813 I186T probably damaging Het
Pnkd G A 1: 74,349,405 probably null Het
Poc1a A G 9: 106,349,709 T334A probably damaging Het
Pou2f2 T A 7: 25,097,686 K211* probably null Het
Rdh13 T C 7: 4,442,653 E94G probably benign Het
Rnf186 A G 4: 138,967,187 S13G probably benign Het
Ryr2 T C 13: 11,655,698 R3471G probably damaging Het
Sbf2 T C 7: 110,372,535 T831A probably damaging Het
Sh3gl2 A G 4: 85,398,166 probably benign Het
Snn T C 16: 11,072,533 V72A probably benign Het
Sys1 T A 2: 164,464,424 H99Q possibly damaging Het
Syt7 A G 19: 10,435,567 K122R probably damaging Het
Tas1r2 T A 4: 139,669,000 L550Q probably damaging Het
Thoc1 T C 18: 9,993,438 I599T probably damaging Het
Tle3 C T 9: 61,373,997 probably benign Het
Tll1 A C 8: 64,085,473 V379G possibly damaging Het
Tnfrsf21 G A 17: 43,037,730 E78K probably benign Het
Tpgs2 A G 18: 25,129,840 probably benign Het
Trpm1 T C 7: 64,208,306 L165P probably damaging Het
Trpm5 T C 7: 143,080,219 Y750C probably damaging Het
Ttbk2 A C 2: 120,740,070 S1201A possibly damaging Het
Ust T A 10: 8,245,941 H301L probably damaging Het
Vwa5a T C 9: 38,735,953 F543L probably benign Het
Yeats2 T A 16: 20,152,895 probably null Het
Zfp85 T C 13: 67,749,626 Y109C probably damaging Het
Zfr2 T A 10: 81,243,713 V362E probably benign Het
Znrf3 A T 11: 5,287,420 C134S probably benign Het
Other mutations in Ccdc180
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01369:Ccdc180 APN 4 45900256 missense probably benign
IGL01713:Ccdc180 APN 4 45921025 critical splice donor site probably null
IGL01915:Ccdc180 APN 4 45904544 missense probably damaging 0.98
IGL01935:Ccdc180 APN 4 45906889 missense possibly damaging 0.71
IGL02539:Ccdc180 APN 4 45921005 missense probably damaging 1.00
IGL02982:Ccdc180 APN 4 45903840 splice site probably benign
IGL03071:Ccdc180 APN 4 45903840 splice site probably benign
IGL03146:Ccdc180 APN 4 45903840 splice site probably benign
PIT4687001:Ccdc180 UTSW 4 45949526 missense probably damaging 1.00
R0049:Ccdc180 UTSW 4 45930119 critical splice acceptor site probably null
R0049:Ccdc180 UTSW 4 45930119 critical splice acceptor site probably null
R0054:Ccdc180 UTSW 4 45890900 missense probably benign 0.01
R0054:Ccdc180 UTSW 4 45890900 missense probably benign 0.01
R0080:Ccdc180 UTSW 4 45896205 missense probably null 0.00
R0082:Ccdc180 UTSW 4 45896205 missense probably null 0.00
R0126:Ccdc180 UTSW 4 45912866 critical splice donor site probably null
R0193:Ccdc180 UTSW 4 45914803 missense probably benign 0.01
R0276:Ccdc180 UTSW 4 45923534 missense probably damaging 1.00
R0362:Ccdc180 UTSW 4 45923551 missense probably damaging 1.00
R0380:Ccdc180 UTSW 4 45930197 critical splice donor site probably null
R0468:Ccdc180 UTSW 4 45923271 missense possibly damaging 0.87
R0539:Ccdc180 UTSW 4 45922010 missense probably damaging 0.97
R0543:Ccdc180 UTSW 4 45900041 nonsense probably null
R0546:Ccdc180 UTSW 4 45904597 missense possibly damaging 0.71
R0612:Ccdc180 UTSW 4 45927969 missense probably damaging 0.98
R0792:Ccdc180 UTSW 4 45927975 missense possibly damaging 0.92
R1056:Ccdc180 UTSW 4 45916375 missense probably benign 0.01
R1099:Ccdc180 UTSW 4 45914225 missense probably benign 0.03
R1136:Ccdc180 UTSW 4 45914589 missense probably benign 0.00
R1263:Ccdc180 UTSW 4 45903887 missense possibly damaging 0.85
R1331:Ccdc180 UTSW 4 45909359 missense possibly damaging 0.51
R1522:Ccdc180 UTSW 4 45927975 missense possibly damaging 0.92
R1819:Ccdc180 UTSW 4 45926195 missense possibly damaging 0.84
R2022:Ccdc180 UTSW 4 45944418 missense probably benign 0.18
R2056:Ccdc180 UTSW 4 45932477 missense probably benign 0.03
R2219:Ccdc180 UTSW 4 45944949 missense probably damaging 1.00
R2228:Ccdc180 UTSW 4 45948856 critical splice donor site probably null
R2229:Ccdc180 UTSW 4 45948856 critical splice donor site probably null
R2255:Ccdc180 UTSW 4 45921996 missense probably damaging 1.00
R2427:Ccdc180 UTSW 4 45929545 missense probably benign 0.03
R3001:Ccdc180 UTSW 4 45899988 missense probably benign
R3002:Ccdc180 UTSW 4 45899988 missense probably benign
R3003:Ccdc180 UTSW 4 45899988 missense probably benign
R3110:Ccdc180 UTSW 4 45900470 missense possibly damaging 0.86
R3111:Ccdc180 UTSW 4 45900470 missense possibly damaging 0.86
R3112:Ccdc180 UTSW 4 45900470 missense possibly damaging 0.86
R3898:Ccdc180 UTSW 4 45912799 missense possibly damaging 0.71
R4022:Ccdc180 UTSW 4 45904560 nonsense probably null
R4084:Ccdc180 UTSW 4 45950632 missense probably benign 0.19
R4377:Ccdc180 UTSW 4 45941877 missense probably damaging 1.00
R4595:Ccdc180 UTSW 4 45945023 missense probably damaging 0.98
R4637:Ccdc180 UTSW 4 45914443 missense probably benign
R4825:Ccdc180 UTSW 4 45912794 missense possibly damaging 0.93
R4858:Ccdc180 UTSW 4 45923244 missense probably damaging 1.00
R4888:Ccdc180 UTSW 4 45909308 missense probably damaging 0.98
R4940:Ccdc180 UTSW 4 45917453 missense probably damaging 0.96
R4940:Ccdc180 UTSW 4 45917508 missense probably damaging 1.00
R5042:Ccdc180 UTSW 4 45916255 missense probably damaging 0.98
R5119:Ccdc180 UTSW 4 45914603 missense possibly damaging 0.72
R5177:Ccdc180 UTSW 4 45917508 missense probably damaging 1.00
R5311:Ccdc180 UTSW 4 45917556 missense probably damaging 1.00
R5333:Ccdc180 UTSW 4 45890935 missense possibly damaging 0.53
R5448:Ccdc180 UTSW 4 45920913 missense probably damaging 1.00
R5510:Ccdc180 UTSW 4 45928046 missense probably damaging 0.96
R6018:Ccdc180 UTSW 4 45926235 missense probably damaging 1.00
R6108:Ccdc180 UTSW 4 45911389 missense possibly damaging 0.71
R6283:Ccdc180 UTSW 4 45902486 missense possibly damaging 0.85
R6483:Ccdc180 UTSW 4 45921950 missense probably benign 0.32
R6618:Ccdc180 UTSW 4 45950708 missense probably damaging 1.00
R7017:Ccdc180 UTSW 4 45940934 missense possibly damaging 0.84
R7205:Ccdc180 UTSW 4 45914588 missense probably benign
R7341:Ccdc180 UTSW 4 45898644 missense possibly damaging 0.85
R7351:Ccdc180 UTSW 4 45903887 missense possibly damaging 0.85
R7418:Ccdc180 UTSW 4 45904616 missense probably damaging 0.98
R7492:Ccdc180 UTSW 4 45930009 splice site probably null
R7573:Ccdc180 UTSW 4 45922015 missense probably benign 0.33
R7639:Ccdc180 UTSW 4 45928043 missense possibly damaging 0.93
R7792:Ccdc180 UTSW 4 45890389 critical splice donor site probably null
R7806:Ccdc180 UTSW 4 45912801 missense possibly damaging 0.85
R7812:Ccdc180 UTSW 4 45906952 critical splice donor site probably null
R7840:Ccdc180 UTSW 4 45900461 missense possibly damaging 0.71
R7842:Ccdc180 UTSW 4 45909428 missense probably benign 0.00
R8712:Ccdc180 UTSW 4 45920842 critical splice acceptor site probably null
R8818:Ccdc180 UTSW 4 45900484 missense probably benign 0.02
R8961:Ccdc180 UTSW 4 45929573 missense possibly damaging 0.74
X0017:Ccdc180 UTSW 4 45909350 missense possibly damaging 0.86
Z1176:Ccdc180 UTSW 4 45916406 missense probably damaging 1.00
Z1176:Ccdc180 UTSW 4 45920910 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAGGACCGTTTTCTGTAAGAG -3'
(R):5'- CACAGTATGCCATCCTTCCATG -3'

Sequencing Primer
(F):5'- CCGTTTTCTGTAAGAGAGAGAGC -3'
(R):5'- ATGTCACCCCAGCTGGTTTG -3'
Posted On2016-02-04