Incidental Mutation 'R4811:Paqr3'
ID369418
Institutional Source Beutler Lab
Gene Symbol Paqr3
Ensembl Gene ENSMUSG00000055725
Gene Nameprogestin and adipoQ receptor family member III
Synonyms6330415A20Rik, RKTG
MMRRC Submission 042430-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R4811 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location97082329-97111596 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 97095983 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 291 (S291A)
Ref Sequence ENSEMBL: ENSMUSP00000108593 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035635] [ENSMUST00000069453] [ENSMUST00000112969] [ENSMUST00000196078]
Predicted Effect probably benign
Transcript: ENSMUST00000035635
SMART Domains Protein: ENSMUSP00000037970
Gene: ENSMUSG00000034663

DomainStartEndE-ValueType
low complexity region 12 37 N/A INTRINSIC
Pfam:Pkinase_Tyr 48 309 8.9e-27 PFAM
Pfam:Pkinase 48 311 1.6e-43 PFAM
coiled coil region 455 490 N/A INTRINSIC
low complexity region 511 538 N/A INTRINSIC
low complexity region 624 636 N/A INTRINSIC
low complexity region 653 664 N/A INTRINSIC
low complexity region 729 753 N/A INTRINSIC
low complexity region 779 794 N/A INTRINSIC
low complexity region 838 852 N/A INTRINSIC
Pfam:BMP2K_C 873 1138 7.9e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000069453
AA Change: S291A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000069324
Gene: ENSMUSG00000055725
AA Change: S291A

DomainStartEndE-ValueType
Pfam:HlyIII 64 289 3.4e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112969
AA Change: S291A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000108593
Gene: ENSMUSG00000055725
AA Change: S291A

DomainStartEndE-ValueType
Pfam:HlyIII 64 289 1.4e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126585
Predicted Effect probably benign
Transcript: ENSMUST00000196078
SMART Domains Protein: ENSMUSP00000142871
Gene: ENSMUSG00000055725

DomainStartEndE-ValueType
Pfam:HlyIII 64 179 7e-24 PFAM
transmembrane domain 181 203 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Targeted deletion of this gene causes faster chemical carcinogen-induced skin cell proliferation, higher epidermal thickness, increased number and size of skin papillomas, shorter tumor latency and delayed tumor regression. Heterozygotes develop tumors earlier and more frequently than control mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447A16Rik G A 15: 37,425,708 probably benign Het
Adam3 C T 8: 24,711,724 G208R probably benign Het
AI481877 T C 4: 59,082,404 N408S probably benign Het
Arsg G T 11: 109,534,072 V290L probably benign Het
Cad A G 5: 31,074,690 T104A probably benign Het
Ccdc180 A G 4: 45,928,020 N1185S probably damaging Het
Cdh18 A G 15: 23,226,791 T113A probably benign Het
Crocc2 G A 1: 93,205,896 A967T probably damaging Het
Cyp4f16 A G 17: 32,545,106 T291A probably benign Het
Dcc T A 18: 71,299,483 H1300L probably benign Het
Ddx23 T A 15: 98,647,471 probably null Het
Dnhd1 T G 7: 105,714,281 S4017A probably damaging Het
Erbb4 A T 1: 68,254,544 F729L probably damaging Het
Ercc6 G T 14: 32,574,929 R1292L probably benign Het
Fam186b C T 15: 99,280,237 V403M probably benign Het
Fam227a T C 15: 79,615,427 N576D possibly damaging Het
Fam46b T C 4: 133,486,370 L184P probably benign Het
Fbln1 A G 15: 85,226,966 probably null Het
Fbxw17 T C 13: 50,425,633 V162A probably benign Het
Gas2l1 A C 11: 5,064,436 I8S probably damaging Het
Gm7030 A G 17: 36,127,776 L241S probably damaging Het
Golgb1 T C 16: 36,891,419 L195P probably damaging Het
Gps2 A T 11: 69,915,928 H233L probably damaging Het
Guf1 T G 5: 69,564,509 probably null Het
Il1rap T A 16: 26,701,238 probably null Het
Ints14 A G 9: 64,964,518 Y46C probably damaging Het
Kalrn T G 16: 34,356,969 Q293H probably damaging Het
Kank2 A G 9: 21,775,747 L593P probably damaging Het
Krt19 T C 11: 100,141,348 T297A possibly damaging Het
Lcp1 T C 14: 75,200,408 V86A probably damaging Het
Lins1 T A 7: 66,708,150 I11K probably benign Het
Lrba T C 3: 86,776,141 F2757L probably damaging Het
Lyst T C 13: 13,777,100 I3762T probably benign Het
Lyzl6 A G 11: 103,635,025 S90P possibly damaging Het
Mfsd2a T A 4: 122,959,382 Q38L probably benign Het
Mtss1 A G 15: 58,944,073 F546S probably damaging Het
Myo5a G A 9: 75,141,543 probably null Het
Naip6 C A 13: 100,285,791 G1245W probably damaging Het
Ndfip1 C T 18: 38,451,592 T107I probably benign Het
Nek8 C T 11: 78,167,718 probably null Het
Nphs1 T C 7: 30,460,429 V55A probably damaging Het
Nrp2 C A 1: 62,719,081 H75Q probably damaging Het
Oas1e C T 5: 120,795,383 S39N probably damaging Het
Olfr1164 A G 2: 88,093,532 F135L probably benign Het
Olfr1391 T G 11: 49,327,748 S112R possibly damaging Het
Olfr309 T C 7: 86,306,958 T52A probably benign Het
Olfr871 A T 9: 20,212,753 I135F probably damaging Het
Pan3 T A 5: 147,530,058 H632Q probably damaging Het
Pcdh17 A C 14: 84,447,935 D614A probably damaging Het
Pcyox1l T C 18: 61,697,535 E422G possibly damaging Het
Pgr G T 9: 8,900,843 E126* probably null Het
Pik3ap1 A G 19: 41,302,497 V532A possibly damaging Het
Pla2g4c T C 7: 13,337,813 I186T probably damaging Het
Pnkd G A 1: 74,349,405 probably null Het
Poc1a A G 9: 106,349,709 T334A probably damaging Het
Pou2f2 T A 7: 25,097,686 K211* probably null Het
Rdh13 T C 7: 4,442,653 E94G probably benign Het
Rnf186 A G 4: 138,967,187 S13G probably benign Het
Ryr2 T C 13: 11,655,698 R3471G probably damaging Het
Sbf2 T C 7: 110,372,535 T831A probably damaging Het
Sh3gl2 A G 4: 85,398,166 probably benign Het
Snn T C 16: 11,072,533 V72A probably benign Het
Sys1 T A 2: 164,464,424 H99Q possibly damaging Het
Syt7 A G 19: 10,435,567 K122R probably damaging Het
Tas1r2 T A 4: 139,669,000 L550Q probably damaging Het
Thoc1 T C 18: 9,993,438 I599T probably damaging Het
Tle3 C T 9: 61,373,997 probably benign Het
Tll1 A C 8: 64,085,473 V379G possibly damaging Het
Tnfrsf21 G A 17: 43,037,730 E78K probably benign Het
Tpgs2 A G 18: 25,129,840 probably benign Het
Trpm1 T C 7: 64,208,306 L165P probably damaging Het
Trpm5 T C 7: 143,080,219 Y750C probably damaging Het
Ttbk2 A C 2: 120,740,070 S1201A possibly damaging Het
Ust T A 10: 8,245,941 H301L probably damaging Het
Vwa5a T C 9: 38,735,953 F543L probably benign Het
Yeats2 T A 16: 20,152,895 probably null Het
Zfp85 T C 13: 67,749,626 Y109C probably damaging Het
Zfr2 T A 10: 81,243,713 V362E probably benign Het
Znrf3 A T 11: 5,287,420 C134S probably benign Het
Other mutations in Paqr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01459:Paqr3 APN 5 97095937 missense probably benign
IGL01966:Paqr3 APN 5 97099643 missense probably benign 0.21
IGL02133:Paqr3 APN 5 97095931 missense probably benign
PIT4618001:Paqr3 UTSW 5 97103471 missense possibly damaging 0.82
R1601:Paqr3 UTSW 5 97111389 missense probably benign 0.01
R2864:Paqr3 UTSW 5 97099736 missense possibly damaging 0.65
R3419:Paqr3 UTSW 5 97099700 missense probably damaging 1.00
R3799:Paqr3 UTSW 5 97111316 missense probably damaging 1.00
R4352:Paqr3 UTSW 5 97099596 missense probably benign 0.05
R4368:Paqr3 UTSW 5 97108291 missense probably damaging 1.00
R4515:Paqr3 UTSW 5 97103361 missense possibly damaging 0.72
R4583:Paqr3 UTSW 5 97108210 nonsense probably null
R4647:Paqr3 UTSW 5 97108210 nonsense probably null
R4648:Paqr3 UTSW 5 97108210 nonsense probably null
R4855:Paqr3 UTSW 5 97108194 missense possibly damaging 0.83
R5910:Paqr3 UTSW 5 97096028 unclassified probably null
R6053:Paqr3 UTSW 5 97111278 missense probably benign 0.12
R6156:Paqr3 UTSW 5 97108269 missense probably damaging 1.00
R6957:Paqr3 UTSW 5 97108251 missense possibly damaging 0.48
R6974:Paqr3 UTSW 5 97108287 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTCAGTTCTTACTACAGATCC -3'
(R):5'- ATTAATCTGGCCAGAGGTCGAC -3'

Sequencing Primer
(F):5'- AAGCACTGTGACTCATCAAATAAG -3'
(R):5'- CCAGAGGTCGACGTGTGTTTTTC -3'
Posted On2016-02-04