Mutagenetix > Incidental Mutation

Incidental Mutation 'R4811:Trpm1'

369427

Institutional Source

Beutler Lab

Gene Symbol

Trpm1

Ensembl Gene

ENSMUSG00000030523

Gene Name

transient receptor potential cation channel, subfamily M, member 1

Synonyms

Mlsn1, 4732499L03Rik, LTRPC1, melastatin

MMRRC Submission

042430-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4811 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

64153835-64269775 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 64208306 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 165 (L165P)

Ref Sequence

ENSEMBL: ENSMUSP00000146265 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085222] [ENSMUST00000177102] [ENSMUST00000205348] [ENSMUST00000205731] [ENSMUST00000205994] [ENSMUST00000206263] [ENSMUST00000206277] [ENSMUST00000206706] [ENSMUST00000206314]

AlphaFold

Q2TV84

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000083651

Predicted Effect

probably damaging
Transcript: ENSMUST00000085222
AA Change: L298P

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000082318
Gene: ENSMUSG00000030523
AA Change: L298P

Domain	Start	End	E-Value	Type
low complexity region	8	28	N/A	INTRINSIC
low complexity region	183	195	N/A	INTRINSIC
low complexity region	289	307	N/A	INTRINSIC
low complexity region	456	491	N/A	INTRINSIC
Blast:ANK	505	533	1e-5	BLAST
low complexity region	621	650	N/A	INTRINSIC
low complexity region	823	835	N/A	INTRINSIC
transmembrane domain	876	895	N/A	INTRINSIC
Pfam:Ion_trans	907	1120	6e-16	PFAM
transmembrane domain	1150	1167	N/A	INTRINSIC
low complexity region	1216	1225	N/A	INTRINSIC
PDB:3E7K\|H	1228	1279	1e-7	PDB

Predicted Effect

probably damaging
Transcript: ENSMUST00000107515
AA Change: L165P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000103139
Gene: ENSMUSG00000030523
AA Change: L165P

Domain	Start	End	E-Value	Type
low complexity region	50	62	N/A	INTRINSIC
low complexity region	156	174	N/A	INTRINSIC
low complexity region	323	358	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000107516
AA Change: *298Q

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141574
AA Change: L354P

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176548
AA Change: *34Q

Predicted Effect

probably damaging
Transcript: ENSMUST00000177102
AA Change: L182P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000134947
Gene: ENSMUSG00000030523
AA Change: L182P

Domain	Start	End	E-Value	Type
low complexity region	67	79	N/A	INTRINSIC
low complexity region	173	191	N/A	INTRINSIC
low complexity region	340	375	N/A	INTRINSIC
Blast:ANK	389	417	1e-5	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000205348
AA Change: L298P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205434

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205610

Predicted Effect

unknown
Transcript: ENSMUST00000205684
AA Change: L33P

Predicted Effect

probably damaging
Transcript: ENSMUST00000205731
AA Change: L182P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205960

Predicted Effect

probably benign
Transcript: ENSMUST00000205994

Predicted Effect

probably damaging
Transcript: ENSMUST00000206263
AA Change: L182P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

Predicted Effect

probably benign
Transcript: ENSMUST00000206277
AA Change: L298P

PolyPhen 2 Score 0.148 (Sensitivity: 0.92; Specificity: 0.87)

Predicted Effect

probably damaging
Transcript: ENSMUST00000206706
AA Change: L165P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206404

Predicted Effect

probably benign
Transcript: ENSMUST00000206314

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206453

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 93.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transient receptor potential melastatin subfamily of transient receptor potential ion channels. The encoded protein is a calcium permeable cation channel that is expressed in melanocytes and may play a role in melanin synthesis. Specific mutations in this gene are the cause autosomal recessive complete congenital stationary night blindness-1C. The expression of this protein is inversely correlated with melanoma aggressiveness and as such it is used as a prognostic marker for melanoma metastasis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutants have defects in rod and cone electrophysiology affecting the photoresponses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930447A16Rik	G	A	15: 37,425,708		probably benign	Het
Adam3	C	T	8: 24,711,724	G208R	probably benign	Het
AI481877	T	C	4: 59,082,404	N408S	probably benign	Het
Arsg	G	T	11: 109,534,072	V290L	probably benign	Het
Cad	A	G	5: 31,074,690	T104A	probably benign	Het
Ccdc180	A	G	4: 45,928,020	N1185S	probably damaging	Het
Cdh18	A	G	15: 23,226,791	T113A	probably benign	Het
Crocc2	G	A	1: 93,205,896	A967T	probably damaging	Het
Cyp4f16	A	G	17: 32,545,106	T291A	probably benign	Het
Dcc	T	A	18: 71,299,483	H1300L	probably benign	Het
Ddx23	T	A	15: 98,647,471		probably null	Het
Dnhd1	T	G	7: 105,714,281	S4017A	probably damaging	Het
Erbb4	A	T	1: 68,254,544	F729L	probably damaging	Het
Ercc6	G	T	14: 32,574,929	R1292L	probably benign	Het
Fam186b	C	T	15: 99,280,237	V403M	probably benign	Het
Fam227a	T	C	15: 79,615,427	N576D	possibly damaging	Het
Fam46b	T	C	4: 133,486,370	L184P	probably benign	Het
Fbln1	A	G	15: 85,226,966		probably null	Het
Fbxw17	T	C	13: 50,425,633	V162A	probably benign	Het
Gas2l1	A	C	11: 5,064,436	I8S	probably damaging	Het
Gm7030	A	G	17: 36,127,776	L241S	probably damaging	Het
Golgb1	T	C	16: 36,891,419	L195P	probably damaging	Het
Gps2	A	T	11: 69,915,928	H233L	probably damaging	Het
Guf1	T	G	5: 69,564,509		probably null	Het
Il1rap	T	A	16: 26,701,238		probably null	Het
Ints14	A	G	9: 64,964,518	Y46C	probably damaging	Het
Kalrn	T	G	16: 34,356,969	Q293H	probably damaging	Het
Kank2	A	G	9: 21,775,747	L593P	probably damaging	Het
Krt19	T	C	11: 100,141,348	T297A	possibly damaging	Het
Lcp1	T	C	14: 75,200,408	V86A	probably damaging	Het
Lins1	T	A	7: 66,708,150	I11K	probably benign	Het
Lrba	T	C	3: 86,776,141	F2757L	probably damaging	Het
Lyst	T	C	13: 13,777,100	I3762T	probably benign	Het
Lyzl6	A	G	11: 103,635,025	S90P	possibly damaging	Het
Mfsd2a	T	A	4: 122,959,382	Q38L	probably benign	Het
Mtss1	A	G	15: 58,944,073	F546S	probably damaging	Het
Myo5a	G	A	9: 75,141,543		probably null	Het
Naip6	C	A	13: 100,285,791	G1245W	probably damaging	Het
Ndfip1	C	T	18: 38,451,592	T107I	probably benign	Het
Nek8	C	T	11: 78,167,718		probably null	Het
Nphs1	T	C	7: 30,460,429	V55A	probably damaging	Het
Nrp2	C	A	1: 62,719,081	H75Q	probably damaging	Het
Oas1e	C	T	5: 120,795,383	S39N	probably damaging	Het
Olfr1164	A	G	2: 88,093,532	F135L	probably benign	Het
Olfr1391	T	G	11: 49,327,748	S112R	possibly damaging	Het
Olfr309	T	C	7: 86,306,958	T52A	probably benign	Het
Olfr871	A	T	9: 20,212,753	I135F	probably damaging	Het
Pan3	T	A	5: 147,530,058	H632Q	probably damaging	Het
Paqr3	A	C	5: 97,095,983	S291A	probably benign	Het
Pcdh17	A	C	14: 84,447,935	D614A	probably damaging	Het
Pcyox1l	T	C	18: 61,697,535	E422G	possibly damaging	Het
Pgr	G	T	9: 8,900,843	E126*	probably null	Het
Pik3ap1	A	G	19: 41,302,497	V532A	possibly damaging	Het
Pla2g4c	T	C	7: 13,337,813	I186T	probably damaging	Het
Pnkd	G	A	1: 74,349,405		probably null	Het
Poc1a	A	G	9: 106,349,709	T334A	probably damaging	Het
Pou2f2	T	A	7: 25,097,686	K211*	probably null	Het
Rdh13	T	C	7: 4,442,653	E94G	probably benign	Het
Rnf186	A	G	4: 138,967,187	S13G	probably benign	Het
Ryr2	T	C	13: 11,655,698	R3471G	probably damaging	Het
Sbf2	T	C	7: 110,372,535	T831A	probably damaging	Het
Sh3gl2	A	G	4: 85,398,166		probably benign	Het
Snn	T	C	16: 11,072,533	V72A	probably benign	Het
Sys1	T	A	2: 164,464,424	H99Q	possibly damaging	Het
Syt7	A	G	19: 10,435,567	K122R	probably damaging	Het
Tas1r2	T	A	4: 139,669,000	L550Q	probably damaging	Het
Thoc1	T	C	18: 9,993,438	I599T	probably damaging	Het
Tle3	C	T	9: 61,373,997		probably benign	Het
Tll1	A	C	8: 64,085,473	V379G	possibly damaging	Het
Tnfrsf21	G	A	17: 43,037,730	E78K	probably benign	Het
Tpgs2	A	G	18: 25,129,840		probably benign	Het
Trpm5	T	C	7: 143,080,219	Y750C	probably damaging	Het
Ttbk2	A	C	2: 120,740,070	S1201A	possibly damaging	Het
Ust	T	A	10: 8,245,941	H301L	probably damaging	Het
Vwa5a	T	C	9: 38,735,953	F543L	probably benign	Het
Yeats2	T	A	16: 20,152,895		probably null	Het
Zfp85	T	C	13: 67,749,626	Y109C	probably damaging	Het
Zfr2	T	A	10: 81,243,713	V362E	probably benign	Het
Znrf3	A	T	11: 5,287,420	C134S	probably benign	Het

Other mutations in Trpm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Trpm1	APN	7	64243450	missense	probably damaging	1.00
IGL00465:Trpm1	APN	7	64247467	missense	possibly damaging	0.94
IGL01118:Trpm1	APN	7	64235824	missense	probably benign	0.24
IGL01148:Trpm1	APN	7	64243564	missense	probably damaging	1.00
IGL01303:Trpm1	APN	7	64210830	critical splice acceptor site	probably benign	0.00
IGL01432:Trpm1	APN	7	64235019	missense	probably benign	0.18
IGL01433:Trpm1	APN	7	64204528	missense	probably damaging	1.00
IGL01506:Trpm1	APN	7	64243581	missense	probably damaging	1.00
IGL01626:Trpm1	APN	7	64268889	missense	probably damaging	1.00
IGL01640:Trpm1	APN	7	64226897	missense	probably damaging	1.00
IGL01899:Trpm1	APN	7	64234994	missense	probably benign	0.24
IGL01959:Trpm1	APN	7	64208975	missense	possibly damaging	0.81
IGL02210:Trpm1	APN	7	64210865	missense	probably damaging	1.00
IGL02268:Trpm1	APN	7	64217614	missense	probably damaging	0.96
IGL02331:Trpm1	APN	7	64235052	missense	probably benign	0.30
IGL02334:Trpm1	APN	7	64245942	critical splice acceptor site	probably null
IGL02407:Trpm1	APN	7	64219121	missense	probably damaging	1.00
IGL02425:Trpm1	APN	7	64240427	missense	probably damaging	0.96
IGL02485:Trpm1	APN	7	64269114	missense	possibly damaging	0.52
IGL02635:Trpm1	APN	7	64199224	missense	probably benign	0.00
IGL02640:Trpm1	APN	7	64219133	missense	probably damaging	0.97
IGL02827:Trpm1	APN	7	64219160	missense	probably null	1.00
PIT4458001:Trpm1	UTSW	7	64268561	missense	possibly damaging	0.94
PIT4544001:Trpm1	UTSW	7	64199250	intron	probably benign
R0012:Trpm1	UTSW	7	64268591	missense	possibly damaging	0.88
R0014:Trpm1	UTSW	7	64248222	missense	probably damaging	1.00
R0056:Trpm1	UTSW	7	64243586	missense	probably damaging	1.00
R0445:Trpm1	UTSW	7	64244842	unclassified	probably benign
R0463:Trpm1	UTSW	7	64220254	missense	probably benign	0.05
R0469:Trpm1	UTSW	7	64223758	missense	probably damaging	1.00
R0510:Trpm1	UTSW	7	64223758	missense	probably damaging	1.00
R1301:Trpm1	UTSW	7	64203053	splice site	probably null
R1397:Trpm1	UTSW	7	64217658	missense	probably damaging	1.00
R1588:Trpm1	UTSW	7	64223817	missense	possibly damaging	0.93
R1618:Trpm1	UTSW	7	64240535	missense	probably damaging	1.00
R1724:Trpm1	UTSW	7	64235821	nonsense	probably null
R1827:Trpm1	UTSW	7	64235007	missense	probably damaging	1.00
R1829:Trpm1	UTSW	7	64226782	missense	probably damaging	1.00
R1835:Trpm1	UTSW	7	64230268	missense	probably damaging	1.00
R1864:Trpm1	UTSW	7	64268016	missense	probably damaging	1.00
R1895:Trpm1	UTSW	7	64223808	missense	probably damaging	1.00
R1946:Trpm1	UTSW	7	64223808	missense	probably damaging	1.00
R1959:Trpm1	UTSW	7	64230230	missense	probably damaging	1.00
R1960:Trpm1	UTSW	7	64230230	missense	probably damaging	1.00
R1980:Trpm1	UTSW	7	64208434	missense	possibly damaging	0.83
R1989:Trpm1	UTSW	7	64209032	intron	probably null
R2054:Trpm1	UTSW	7	64240555	missense	possibly damaging	0.69
R2156:Trpm1	UTSW	7	64234988	missense	probably damaging	1.00
R2251:Trpm1	UTSW	7	64209976	missense	probably damaging	1.00
R3051:Trpm1	UTSW	7	64269101	missense	probably damaging	1.00
R3148:Trpm1	UTSW	7	64235012	missense	probably benign	0.00
R3195:Trpm1	UTSW	7	64199313	nonsense	probably null
R3615:Trpm1	UTSW	7	64243570	missense	probably damaging	1.00
R3616:Trpm1	UTSW	7	64243570	missense	probably damaging	1.00
R3623:Trpm1	UTSW	7	64244853	missense	probably damaging	1.00
R3624:Trpm1	UTSW	7	64244853	missense	probably damaging	1.00
R3721:Trpm1	UTSW	7	64217727	intron	probably benign
R3822:Trpm1	UTSW	7	64217703	intron	probably benign
R4441:Trpm1	UTSW	7	64201918	missense	probably damaging	1.00
R4490:Trpm1	UTSW	7	64208912	nonsense	probably null
R4666:Trpm1	UTSW	7	64203034	missense	probably damaging	1.00
R4701:Trpm1	UTSW	7	64243500	missense	probably damaging	1.00
R4781:Trpm1	UTSW	7	64235052	missense	probably benign	0.30
R5017:Trpm1	UTSW	7	64244832	unclassified	probably benign
R5030:Trpm1	UTSW	7	64235831	missense	probably damaging	1.00
R5195:Trpm1	UTSW	7	64237693	missense	possibly damaging	0.84
R5238:Trpm1	UTSW	7	64268954	missense	probably damaging	1.00
R5304:Trpm1	UTSW	7	64208946	missense	probably benign	0.00
R5575:Trpm1	UTSW	7	64220270	missense	possibly damaging	0.95
R5613:Trpm1	UTSW	7	64208411	missense	probably damaging	1.00
R5855:Trpm1	UTSW	7	64268962	nonsense	probably null
R5947:Trpm1	UTSW	7	64223799	missense	probably benign	0.07
R5988:Trpm1	UTSW	7	64226805	missense	probably benign	0.16
R6054:Trpm1	UTSW	7	64268702	missense	probably benign	0.00
R6088:Trpm1	UTSW	7	64267976	missense	probably damaging	0.98
R6259:Trpm1	UTSW	7	64268478	missense	possibly damaging	0.47
R6379:Trpm1	UTSW	7	64199194	missense	probably benign	0.00
R6380:Trpm1	UTSW	7	64268297	missense	probably benign	0.24
R6429:Trpm1	UTSW	7	64268504	missense	probably benign	0.00
R6600:Trpm1	UTSW	7	64154033	start codon destroyed	probably null	0.56
R6622:Trpm1	UTSW	7	64240595	missense	probably damaging	0.96
R6939:Trpm1	UTSW	7	64268297	missense	probably benign	0.03
R6944:Trpm1	UTSW	7	64243433	missense	probably damaging	1.00
R7025:Trpm1	UTSW	7	64226714	critical splice acceptor site	probably null
R7112:Trpm1	UTSW	7	64235845	missense	probably damaging	0.97
R7168:Trpm1	UTSW	7	64268697	missense	probably benign	0.01
R7219:Trpm1	UTSW	7	64204585	missense	possibly damaging	0.68
R7224:Trpm1	UTSW	7	64219106	critical splice acceptor site	probably null
R7285:Trpm1	UTSW	7	64209981	nonsense	probably null
R7367:Trpm1	UTSW	7	64268801	missense	probably benign	0.06
R7449:Trpm1	UTSW	7	64208975	missense	probably benign	0.14
R7466:Trpm1	UTSW	7	64240582	missense	probably damaging	0.99
R7498:Trpm1	UTSW	7	64208909	missense	possibly damaging	0.93
R7581:Trpm1	UTSW	7	64204555	missense	probably benign	0.00
R7776:Trpm1	UTSW	7	64248191	missense	probably benign	0.04
R8062:Trpm1	UTSW	7	64201941	missense	probably benign	0.18
R8069:Trpm1	UTSW	7	64208970	missense	possibly damaging	0.55
R8157:Trpm1	UTSW	7	64199269	missense	probably damaging	1.00
R8219:Trpm1	UTSW	7	64201951	missense	probably benign	0.35
R8258:Trpm1	UTSW	7	64269029	missense	probably benign	0.10
R8259:Trpm1	UTSW	7	64269029	missense	probably benign	0.10
R8320:Trpm1	UTSW	7	64268793	missense	possibly damaging	0.56
R8536:Trpm1	UTSW	7	64247407	missense	probably damaging	1.00
R8544:Trpm1	UTSW	7	64224608	splice site	probably null
R8813:Trpm1	UTSW	7	64202008	missense	possibly damaging	0.68
R8912:Trpm1	UTSW	7	64268880	missense	probably benign	0.06
R8954:Trpm1	UTSW	7	64208341	missense	probably damaging	0.98
R9139:Trpm1	UTSW	7	64199195	missense	probably benign	0.00
R9205:Trpm1	UTSW	7	64240571	missense	possibly damaging	0.66
R9258:Trpm1	UTSW	7	64234965	missense	probably benign	0.01
R9283:Trpm1	UTSW	7	64223875	missense	probably benign	0.18
R9394:Trpm1	UTSW	7	64268732	missense	probably benign	0.00
R9430:Trpm1	UTSW	7	64223698	missense	probably benign	0.38
R9537:Trpm1	UTSW	7	64153868	unclassified	probably benign
R9616:Trpm1	UTSW	7	64208384	missense	probably damaging	0.99
R9774:Trpm1	UTSW	7	64248293	missense	possibly damaging	0.90
X0026:Trpm1	UTSW	7	64268910	missense	probably benign	0.05
Z1176:Trpm1	UTSW	7	64203131	critical splice donor site	probably null
Z1176:Trpm1	UTSW	7	64204594	critical splice donor site	probably null
Z1177:Trpm1	UTSW	7	64217691	missense	unknown

Predicted Primers

PCR Primer
(F):5'- ACAGTCACCCTTCGCTTGAC -3'
(R):5'- GTGTCAGATGTTTTCCCCAGTCTG -3'

Sequencing Primer
(F):5'- GACTTAGTCGAAGCATTGGTCAAC -3'
(R):5'- TGTTTTCCCCAGTCTGACAAAAAGC -3'

Posted On

2016-02-04