Mutagenetix > Incidental Mutations

Incidental Mutation 'R4811:Tll1'

369434

Institutional Source

Beutler Lab

Gene Symbol

Tll1

Ensembl Gene

ENSMUSG00000053626

Gene Name

tolloid-like

Synonyms

Tll-1

MMRRC Submission

042430-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4811 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

64014931-64206271 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 64085473 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Glycine at position 379 (V379G)

Ref Sequence

ENSEMBL: ENSMUSP00000070560 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066166]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000066166
AA Change: V379G

PolyPhen 2 Score 0.721 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000070560
Gene: ENSMUSG00000053626
AA Change: V379G

Domain	Start	End	E-Value	Type
ZnMc	153	295	4.12e-56	SMART
CUB	349	461	4.12e-44	SMART
CUB	462	574	3.81e-48	SMART
EGF_CA	574	615	2.28e-9	SMART
CUB	618	730	9.11e-46	SMART
EGF_CA	730	770	4.25e-9	SMART
CUB	774	886	2.01e-47	SMART
CUB	887	1003	7.19e-35	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000209451

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 93.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an astacin-like, zinc-dependent, metalloprotease that belongs to the peptidase M12A family. This protease processes procollagen C-propeptides, such as chordin, pro-biglycan and pro-lysyl oxidase. Studies in mice suggest that this gene plays multiple roles in the development of mammalian heart, and is essential for the formation of the interventricular septum. Allelic variants of this gene are associated with atrial septal defect type 6. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Homozygous null mice are embryonic lethal with death at midgestation from cardiac failure. Cardiac defects include incomplete formation of the ventricular septum and abnormal positioning of the heart and aorta. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930447A16Rik	G	A	15: 37,425,708		probably benign	Het
Adam3	C	T	8: 24,711,724	G208R	probably benign	Het
AI481877	T	C	4: 59,082,404	N408S	probably benign	Het
Arsg	G	T	11: 109,534,072	V290L	probably benign	Het
Cad	A	G	5: 31,074,690	T104A	probably benign	Het
Ccdc180	A	G	4: 45,928,020	N1185S	probably damaging	Het
Cdh18	A	G	15: 23,226,791	T113A	probably benign	Het
Crocc2	G	A	1: 93,205,896	A967T	probably damaging	Het
Cyp4f16	A	G	17: 32,545,106	T291A	probably benign	Het
Dcc	T	A	18: 71,299,483	H1300L	probably benign	Het
Ddx23	T	A	15: 98,647,471		probably null	Het
Dnhd1	T	G	7: 105,714,281	S4017A	probably damaging	Het
Erbb4	A	T	1: 68,254,544	F729L	probably damaging	Het
Ercc6	G	T	14: 32,574,929	R1292L	probably benign	Het
Fam186b	C	T	15: 99,280,237	V403M	probably benign	Het
Fam227a	T	C	15: 79,615,427	N576D	possibly damaging	Het
Fam46b	T	C	4: 133,486,370	L184P	probably benign	Het
Fbln1	A	G	15: 85,226,966		probably null	Het
Fbxw17	T	C	13: 50,425,633	V162A	probably benign	Het
Gas2l1	A	C	11: 5,064,436	I8S	probably damaging	Het
Gm7030	A	G	17: 36,127,776	L241S	probably damaging	Het
Golgb1	T	C	16: 36,891,419	L195P	probably damaging	Het
Gps2	A	T	11: 69,915,928	H233L	probably damaging	Het
Guf1	T	G	5: 69,564,509		probably null	Het
Il1rap	T	A	16: 26,701,238		probably null	Het
Ints14	A	G	9: 64,964,518	Y46C	probably damaging	Het
Kalrn	T	G	16: 34,356,969	Q293H	probably damaging	Het
Kank2	A	G	9: 21,775,747	L593P	probably damaging	Het
Krt19	T	C	11: 100,141,348	T297A	possibly damaging	Het
Lcp1	T	C	14: 75,200,408	V86A	probably damaging	Het
Lins1	T	A	7: 66,708,150	I11K	probably benign	Het
Lrba	T	C	3: 86,776,141	F2757L	probably damaging	Het
Lyst	T	C	13: 13,777,100	I3762T	probably benign	Het
Lyzl6	A	G	11: 103,635,025	S90P	possibly damaging	Het
Mfsd2a	T	A	4: 122,959,382	Q38L	probably benign	Het
Mtss1	A	G	15: 58,944,073	F546S	probably damaging	Het
Myo5a	G	A	9: 75,141,543		probably null	Het
Naip6	C	A	13: 100,285,791	G1245W	probably damaging	Het
Ndfip1	C	T	18: 38,451,592	T107I	probably benign	Het
Nek8	C	T	11: 78,167,718		probably null	Het
Nphs1	T	C	7: 30,460,429	V55A	probably damaging	Het
Nrp2	C	A	1: 62,719,081	H75Q	probably damaging	Het
Oas1e	C	T	5: 120,795,383	S39N	probably damaging	Het
Olfr1164	A	G	2: 88,093,532	F135L	probably benign	Het
Olfr1391	T	G	11: 49,327,748	S112R	possibly damaging	Het
Olfr309	T	C	7: 86,306,958	T52A	probably benign	Het
Olfr871	A	T	9: 20,212,753	I135F	probably damaging	Het
Pan3	T	A	5: 147,530,058	H632Q	probably damaging	Het
Paqr3	A	C	5: 97,095,983	S291A	probably benign	Het
Pcdh17	A	C	14: 84,447,935	D614A	probably damaging	Het
Pcyox1l	T	C	18: 61,697,535	E422G	possibly damaging	Het
Pgr	G	T	9: 8,900,843	E126*	probably null	Het
Pik3ap1	A	G	19: 41,302,497	V532A	possibly damaging	Het
Pla2g4c	T	C	7: 13,337,813	I186T	probably damaging	Het
Pnkd	G	A	1: 74,349,405		probably null	Het
Poc1a	A	G	9: 106,349,709	T334A	probably damaging	Het
Pou2f2	T	A	7: 25,097,686	K211*	probably null	Het
Rdh13	T	C	7: 4,442,653	E94G	probably benign	Het
Rnf186	A	G	4: 138,967,187	S13G	probably benign	Het
Ryr2	T	C	13: 11,655,698	R3471G	probably damaging	Het
Sbf2	T	C	7: 110,372,535	T831A	probably damaging	Het
Sh3gl2	A	G	4: 85,398,166		probably benign	Het
Snn	T	C	16: 11,072,533	V72A	probably benign	Het
Sys1	T	A	2: 164,464,424	H99Q	possibly damaging	Het
Syt7	A	G	19: 10,435,567	K122R	probably damaging	Het
Tas1r2	T	A	4: 139,669,000	L550Q	probably damaging	Het
Thoc1	T	C	18: 9,993,438	I599T	probably damaging	Het
Tle3	C	T	9: 61,373,997		probably benign	Het
Tnfrsf21	G	A	17: 43,037,730	E78K	probably benign	Het
Tpgs2	A	G	18: 25,129,840		probably benign	Het
Trpm1	T	C	7: 64,208,306	L165P	probably damaging	Het
Trpm5	T	C	7: 143,080,219	Y750C	probably damaging	Het
Ttbk2	A	C	2: 120,740,070	S1201A	possibly damaging	Het
Ust	T	A	10: 8,245,941	H301L	probably damaging	Het
Vwa5a	T	C	9: 38,735,953	F543L	probably benign	Het
Yeats2	T	A	16: 20,152,895		probably null	Het
Zfp85	T	C	13: 67,749,626	Y109C	probably damaging	Het
Zfr2	T	A	10: 81,243,713	V362E	probably benign	Het
Znrf3	A	T	11: 5,287,420	C134S	probably benign	Het

Other mutations in Tll1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00163:Tll1	APN	8	64016136	missense	probably benign
IGL00583:Tll1	APN	8	64205292	missense	probably benign
IGL00767:Tll1	APN	8	64071321	missense	probably damaging	1.00
IGL01061:Tll1	APN	8	64038454	critical splice donor site	probably null
IGL01077:Tll1	APN	8	64070232	missense	probably benign	0.27
IGL01536:Tll1	APN	8	64074289	missense	probably damaging	1.00
IGL02137:Tll1	APN	8	64016098	missense	possibly damaging	0.73
IGL02168:Tll1	APN	8	64053967	missense	possibly damaging	0.50
IGL02378:Tll1	APN	8	64017626	nonsense	probably null
IGL02469:Tll1	APN	8	64070280	missense	probably benign	0.41
IGL02504:Tll1	APN	8	64070237	missense	possibly damaging	0.55
IGL02650:Tll1	APN	8	64046997	splice site	probably benign
IGL02937:Tll1	APN	8	64205285	nonsense	probably null
IGL03006:Tll1	APN	8	64074217	splice site	probably benign
R0518:Tll1	UTSW	8	64098471	missense	probably damaging	1.00
R0521:Tll1	UTSW	8	64098471	missense	probably damaging	1.00
R0541:Tll1	UTSW	8	64038452	splice site	probably null
R0612:Tll1	UTSW	8	64071310	missense	possibly damaging	0.91
R0690:Tll1	UTSW	8	64074290	missense	probably damaging	0.99
R0738:Tll1	UTSW	8	64101950	missense	probably damaging	1.00
R1454:Tll1	UTSW	8	64038490	missense	probably benign
R1619:Tll1	UTSW	8	64056273	missense	probably benign	0.25
R1625:Tll1	UTSW	8	64041442	missense	probably damaging	1.00
R1654:Tll1	UTSW	8	64117903	critical splice donor site	probably null
R1663:Tll1	UTSW	8	64017686	missense	probably benign	0.08
R1681:Tll1	UTSW	8	64085551	missense	possibly damaging	0.93
R1713:Tll1	UTSW	8	64101873	missense	probably damaging	0.99
R1908:Tll1	UTSW	8	64025107	missense	probably damaging	0.98
R2118:Tll1	UTSW	8	64085557	missense	probably benign	0.21
R2121:Tll1	UTSW	8	64085557	missense	probably benign	0.21
R2124:Tll1	UTSW	8	64085557	missense	probably benign	0.21
R2360:Tll1	UTSW	8	64051401	missense	probably damaging	1.00
R2396:Tll1	UTSW	8	64070290	nonsense	probably null
R3032:Tll1	UTSW	8	64098492	missense	probably damaging	0.96
R3115:Tll1	UTSW	8	64053866	missense	probably damaging	1.00
R3889:Tll1	UTSW	8	64205224	missense	possibly damaging	0.77
R4126:Tll1	UTSW	8	64118014	missense	possibly damaging	0.78
R4182:Tll1	UTSW	8	64041511	missense	probably damaging	1.00
R4572:Tll1	UTSW	8	64056309	missense	possibly damaging	0.81
R4677:Tll1	UTSW	8	64051377	missense	probably benign	0.31
R4904:Tll1	UTSW	8	64070199	missense	probably benign	0.00
R4992:Tll1	UTSW	8	64093944	missense	probably damaging	0.98
R5061:Tll1	UTSW	8	64053949	missense	probably damaging	0.99
R5078:Tll1	UTSW	8	64093887	missense	probably damaging	1.00
R5208:Tll1	UTSW	8	64051493	missense	probably damaging	0.99
R5283:Tll1	UTSW	8	64101966	missense	possibly damaging	0.68
R5399:Tll1	UTSW	8	64085488	missense	probably damaging	1.00
R5699:Tll1	UTSW	8	64117940	missense	probably damaging	0.98
R5986:Tll1	UTSW	8	64074263	missense	probably damaging	0.99
R6019:Tll1	UTSW	8	64041491	missense	possibly damaging	0.83
R6046:Tll1	UTSW	8	64053891	nonsense	probably null
R6083:Tll1	UTSW	8	64038586	splice site	probably null
R6125:Tll1	UTSW	8	64051487	missense	probably damaging	1.00
R6222:Tll1	UTSW	8	64098534	missense	probably benign	0.18
R6275:Tll1	UTSW	8	64051367	nonsense	probably null
R6508:Tll1	UTSW	8	64098460	missense	probably damaging	0.99
R6758:Tll1	UTSW	8	64041405	critical splice donor site	probably null
R6782:Tll1	UTSW	8	64071281	missense	probably benign	0.00
R6848:Tll1	UTSW	8	64098510	missense	probably damaging	0.99
R7057:Tll1	UTSW	8	64101881	missense	probably damaging	1.00
R7144:Tll1	UTSW	8	64124945	missense	possibly damaging	0.90
R7244:Tll1	UTSW	8	64025188	missense	probably benign	0.00
R7336:Tll1	UTSW	8	64025142	missense	probably damaging	0.98
R7373:Tll1	UTSW	8	64051357	missense	probably damaging	0.98
R7626:Tll1	UTSW	8	64098234	splice site	probably null
R7687:Tll1	UTSW	8	64121492	nonsense	probably null
R7699:Tll1	UTSW	8	64093954	missense	probably benign	0.00
R7700:Tll1	UTSW	8	64093954	missense	probably benign	0.00
R7765:Tll1	UTSW	8	64051449	missense	probably damaging	1.00
R7790:Tll1	UTSW	8	64025237	nonsense	probably null
R7954:Tll1	UTSW	8	64118534	missense	probably damaging	1.00
X0020:Tll1	UTSW	8	64017628	missense	probably damaging	0.97
Z1176:Tll1	UTSW	8	64047163	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTTGGGAAACTTACAAAGACCCC -3'
(R):5'- TTTGGGGATATAGAGCCAGCAC -3'

Sequencing Primer
(F):5'- GCTCACTAGGAAAGTATTTGCCTAGC -3'
(R):5'- GGATATAGAGCCAGCACTAGTTAC -3'

Posted On

2016-02-04