Incidental Mutation 'R4811:Myo5a'
ID 369441
Institutional Source Beutler Lab
Gene Symbol Myo5a
Ensembl Gene ENSMUSG00000034593
Gene Name myosin VA
Synonyms flail, Myo5, MVa, Dbv, 9630007J19Rik, MyoVA
MMRRC Submission 042430-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.958) question?
Stock # R4811 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 74978297-75130970 bp(+) (GRCm39)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 75048825 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000123128] [ENSMUST00000123128] [ENSMUST00000123531] [ENSMUST00000136731] [ENSMUST00000136731] [ENSMUST00000155282] [ENSMUST00000155282]
AlphaFold Q99104
Predicted Effect probably null
Transcript: ENSMUST00000123128
SMART Domains Protein: ENSMUSP00000116028
Gene: ENSMUSG00000034593

DomainStartEndE-ValueType
MYSc 63 764 N/A SMART
IQ 765 787 3.65e-4 SMART
IQ 788 810 1.56e-3 SMART
IQ 813 835 3.05e-6 SMART
IQ 836 858 8.38e-4 SMART
IQ 861 883 1.09e-2 SMART
IQ 884 906 6.97e0 SMART
coiled coil region 1153 1234 N/A INTRINSIC
coiled coil region 1314 1364 N/A INTRINSIC
coiled coil region 1406 1443 N/A INTRINSIC
DIL 1685 1790 2.47e-51 SMART
Predicted Effect probably null
Transcript: ENSMUST00000123128
SMART Domains Protein: ENSMUSP00000116028
Gene: ENSMUSG00000034593

DomainStartEndE-ValueType
MYSc 63 764 N/A SMART
IQ 765 787 3.65e-4 SMART
IQ 788 810 1.56e-3 SMART
IQ 813 835 3.05e-6 SMART
IQ 836 858 8.38e-4 SMART
IQ 861 883 1.09e-2 SMART
IQ 884 906 6.97e0 SMART
coiled coil region 1153 1234 N/A INTRINSIC
coiled coil region 1314 1364 N/A INTRINSIC
coiled coil region 1406 1443 N/A INTRINSIC
DIL 1685 1790 2.47e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123531
Predicted Effect probably null
Transcript: ENSMUST00000136731
SMART Domains Protein: ENSMUSP00000120444
Gene: ENSMUSG00000034593

DomainStartEndE-ValueType
MYSc 63 764 N/A SMART
IQ 765 787 3.65e-4 SMART
IQ 788 810 1.56e-3 SMART
IQ 813 835 3.05e-6 SMART
IQ 836 858 8.38e-4 SMART
IQ 861 883 1.09e-2 SMART
IQ 884 906 6.97e0 SMART
coiled coil region 1153 1234 N/A INTRINSIC
coiled coil region 1314 1418 N/A INTRINSIC
DIL 1660 1765 2.47e-51 SMART
Predicted Effect probably null
Transcript: ENSMUST00000136731
SMART Domains Protein: ENSMUSP00000120444
Gene: ENSMUSG00000034593

DomainStartEndE-ValueType
MYSc 63 764 N/A SMART
IQ 765 787 3.65e-4 SMART
IQ 788 810 1.56e-3 SMART
IQ 813 835 3.05e-6 SMART
IQ 836 858 8.38e-4 SMART
IQ 861 883 1.09e-2 SMART
IQ 884 906 6.97e0 SMART
coiled coil region 1153 1234 N/A INTRINSIC
coiled coil region 1314 1418 N/A INTRINSIC
DIL 1660 1765 2.47e-51 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142181
Predicted Effect probably null
Transcript: ENSMUST00000155282
SMART Domains Protein: ENSMUSP00000117493
Gene: ENSMUSG00000034593

DomainStartEndE-ValueType
MYSc 63 764 N/A SMART
IQ 765 787 3.65e-4 SMART
IQ 788 810 1.56e-3 SMART
IQ 813 835 3.05e-6 SMART
IQ 836 858 8.38e-4 SMART
IQ 861 883 1.09e-2 SMART
IQ 884 906 6.97e0 SMART
coiled coil region 1153 1234 N/A INTRINSIC
coiled coil region 1339 1445 N/A INTRINSIC
DIL 1687 1792 2.47e-51 SMART
Predicted Effect probably null
Transcript: ENSMUST00000155282
SMART Domains Protein: ENSMUSP00000117493
Gene: ENSMUSG00000034593

DomainStartEndE-ValueType
MYSc 63 764 N/A SMART
IQ 765 787 3.65e-4 SMART
IQ 788 810 1.56e-3 SMART
IQ 813 835 3.05e-6 SMART
IQ 836 858 8.38e-4 SMART
IQ 861 883 1.09e-2 SMART
IQ 884 906 6.97e0 SMART
coiled coil region 1153 1234 N/A INTRINSIC
coiled coil region 1339 1445 N/A INTRINSIC
DIL 1687 1792 2.47e-51 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of three myosin V heavy-chain genes, belonging to the myosin gene superfamily. Myosin V is a class of actin-based motor proteins involved in cytoplasmic vesicle transport and anchorage, spindle-pole alignment and mRNA translocation. The protein encoded by this gene is abundant in melanocytes and nerve cells. Mutations in this gene cause Griscelli syndrome type-1 (GS1), Griscelli syndrome type-3 (GS3) and neuroectodermal melanolysosomal disease, or Elejalde disease. Multiple alternatively spliced transcript variants encoding different isoforms have been reported, but the full-length nature of some variants has not been determined. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mutations in this gene result in diluted coat color, behavioral deficits including opisthotonus, and postnatal or premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447A16Rik G A 15: 37,425,952 (GRCm39) probably benign Het
Adam3 C T 8: 25,201,740 (GRCm39) G208R probably benign Het
Arsg G T 11: 109,424,898 (GRCm39) V290L probably benign Het
Cad A G 5: 31,232,034 (GRCm39) T104A probably benign Het
Ccdc180 A G 4: 45,928,020 (GRCm39) N1185S probably damaging Het
Cdh18 A G 15: 23,226,877 (GRCm39) T113A probably benign Het
Crocc2 G A 1: 93,133,618 (GRCm39) A967T probably damaging Het
Cyp4f16 A G 17: 32,764,080 (GRCm39) T291A probably benign Het
Dcc T A 18: 71,432,554 (GRCm39) H1300L probably benign Het
Ddx23 T A 15: 98,545,352 (GRCm39) probably null Het
Dnhd1 T G 7: 105,363,488 (GRCm39) S4017A probably damaging Het
Erbb4 A T 1: 68,293,703 (GRCm39) F729L probably damaging Het
Ercc6 G T 14: 32,296,886 (GRCm39) R1292L probably benign Het
Fam186b C T 15: 99,178,118 (GRCm39) V403M probably benign Het
Fam227a T C 15: 79,499,628 (GRCm39) N576D possibly damaging Het
Fbln1 A G 15: 85,111,167 (GRCm39) probably null Het
Fbxw17 T C 13: 50,579,669 (GRCm39) V162A probably benign Het
Gas2l1 A C 11: 5,014,436 (GRCm39) I8S probably damaging Het
Golgb1 T C 16: 36,711,781 (GRCm39) L195P probably damaging Het
Gps2 A T 11: 69,806,754 (GRCm39) H233L probably damaging Het
Guf1 T G 5: 69,721,852 (GRCm39) probably null Het
H2-T9 A G 17: 36,438,668 (GRCm39) L241S probably damaging Het
Il1rap T A 16: 26,519,988 (GRCm39) probably null Het
Ints14 A G 9: 64,871,800 (GRCm39) Y46C probably damaging Het
Kalrn T G 16: 34,177,339 (GRCm39) Q293H probably damaging Het
Kank2 A G 9: 21,687,043 (GRCm39) L593P probably damaging Het
Krt19 T C 11: 100,032,174 (GRCm39) T297A possibly damaging Het
Lcp1 T C 14: 75,437,848 (GRCm39) V86A probably damaging Het
Lins1 T A 7: 66,357,898 (GRCm39) I11K probably benign Het
Lrba T C 3: 86,683,448 (GRCm39) F2757L probably damaging Het
Lyst T C 13: 13,951,685 (GRCm39) I3762T probably benign Het
Lyzl6 A G 11: 103,525,851 (GRCm39) S90P possibly damaging Het
Mfsd2a T A 4: 122,853,175 (GRCm39) Q38L probably benign Het
Mtss1 A G 15: 58,815,922 (GRCm39) F546S probably damaging Het
Naip6 C A 13: 100,422,299 (GRCm39) G1245W probably damaging Het
Ndfip1 C T 18: 38,584,645 (GRCm39) T107I probably benign Het
Nek8 C T 11: 78,058,544 (GRCm39) probably null Het
Nphs1 T C 7: 30,159,854 (GRCm39) V55A probably damaging Het
Nrp2 C A 1: 62,758,240 (GRCm39) H75Q probably damaging Het
Oas1e C T 5: 120,933,448 (GRCm39) S39N probably damaging Het
Or13g1 T C 7: 85,956,166 (GRCm39) T52A probably benign Het
Or2y1e T G 11: 49,218,575 (GRCm39) S112R possibly damaging Het
Or5d37 A G 2: 87,923,876 (GRCm39) F135L probably benign Het
Or7h8 A T 9: 20,124,049 (GRCm39) I135F probably damaging Het
Pan3 T A 5: 147,466,868 (GRCm39) H632Q probably damaging Het
Paqr3 A C 5: 97,243,842 (GRCm39) S291A probably benign Het
Pcdh17 A C 14: 84,685,375 (GRCm39) D614A probably damaging Het
Pcyox1l T C 18: 61,830,606 (GRCm39) E422G possibly damaging Het
Pgr G T 9: 8,900,844 (GRCm39) E126* probably null Het
Pik3ap1 A G 19: 41,290,936 (GRCm39) V532A possibly damaging Het
Pla2g4c T C 7: 13,071,738 (GRCm39) I186T probably damaging Het
Pnkd G A 1: 74,388,564 (GRCm39) probably null Het
Poc1a A G 9: 106,226,908 (GRCm39) T334A probably damaging Het
Pou2f2 T A 7: 24,797,111 (GRCm39) K211* probably null Het
Rdh13 T C 7: 4,445,652 (GRCm39) E94G probably benign Het
Rnf186 A G 4: 138,694,498 (GRCm39) S13G probably benign Het
Ryr2 T C 13: 11,670,584 (GRCm39) R3471G probably damaging Het
Sbf2 T C 7: 109,971,742 (GRCm39) T831A probably damaging Het
Sh3gl2 A G 4: 85,316,403 (GRCm39) probably benign Het
Shoc1 T C 4: 59,082,404 (GRCm39) N408S probably benign Het
Snn T C 16: 10,890,397 (GRCm39) V72A probably benign Het
Sys1 T A 2: 164,306,344 (GRCm39) H99Q possibly damaging Het
Syt7 A G 19: 10,412,931 (GRCm39) K122R probably damaging Het
Tas1r2 T A 4: 139,396,311 (GRCm39) L550Q probably damaging Het
Tent5b T C 4: 133,213,681 (GRCm39) L184P probably benign Het
Thoc1 T C 18: 9,993,438 (GRCm39) I599T probably damaging Het
Tle3 C T 9: 61,281,279 (GRCm39) probably benign Het
Tll1 A C 8: 64,538,507 (GRCm39) V379G possibly damaging Het
Tnfrsf21 G A 17: 43,348,621 (GRCm39) E78K probably benign Het
Tpgs2 A G 18: 25,262,897 (GRCm39) probably benign Het
Trpm1 T C 7: 63,858,054 (GRCm39) L165P probably damaging Het
Trpm5 T C 7: 142,633,956 (GRCm39) Y750C probably damaging Het
Ttbk2 A C 2: 120,570,551 (GRCm39) S1201A possibly damaging Het
Ust T A 10: 8,121,705 (GRCm39) H301L probably damaging Het
Vwa5a T C 9: 38,647,249 (GRCm39) F543L probably benign Het
Yeats2 T A 16: 19,971,645 (GRCm39) probably null Het
Zfp85 T C 13: 67,897,745 (GRCm39) Y109C probably damaging Het
Zfr2 T A 10: 81,079,547 (GRCm39) V362E probably benign Het
Znrf3 A T 11: 5,237,420 (GRCm39) C134S probably benign Het
Other mutations in Myo5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Myo5a APN 9 75,068,779 (GRCm39) nonsense probably null
IGL00547:Myo5a APN 9 75,048,735 (GRCm39) missense probably benign 0.00
IGL00788:Myo5a APN 9 75,076,241 (GRCm39) missense probably benign 0.15
IGL01327:Myo5a APN 9 75,094,820 (GRCm39) splice site probably benign
IGL01687:Myo5a APN 9 75,063,531 (GRCm39) missense probably benign 0.12
IGL01886:Myo5a APN 9 75,076,372 (GRCm39) splice site probably benign
IGL01945:Myo5a APN 9 75,047,953 (GRCm39) missense probably damaging 1.00
IGL02127:Myo5a APN 9 75,120,263 (GRCm39) missense probably benign 0.12
IGL02137:Myo5a APN 9 75,068,817 (GRCm39) splice site probably null
IGL02183:Myo5a APN 9 75,074,518 (GRCm39) splice site probably benign
IGL02427:Myo5a APN 9 75,083,900 (GRCm39) splice site probably benign
IGL02490:Myo5a APN 9 75,043,737 (GRCm39) missense probably damaging 1.00
IGL02574:Myo5a APN 9 75,118,429 (GRCm39) missense probably benign 0.00
IGL02886:Myo5a APN 9 75,059,169 (GRCm39) splice site probably benign
IGL02961:Myo5a APN 9 75,122,402 (GRCm39) missense probably benign 0.04
IGL03090:Myo5a APN 9 75,028,115 (GRCm39) missense probably damaging 1.00
IGL03119:Myo5a APN 9 75,081,297 (GRCm39) missense probably benign 0.01
IGL03237:Myo5a APN 9 75,037,276 (GRCm39) missense probably damaging 1.00
IGL03296:Myo5a APN 9 75,023,484 (GRCm39) missense probably damaging 1.00
naoki UTSW 9 75,068,774 (GRCm39) missense probably damaging 1.00
new_gray UTSW 9 0 () missense
nut UTSW 9 0 () splice donor site
silver_decerebrate UTSW 9 75,071,477 (GRCm39) missense probably damaging 1.00
silver_decerebrate_2 UTSW 9 75,118,408 (GRCm39) missense probably damaging 1.00
IGL02988:Myo5a UTSW 9 75,037,423 (GRCm39) splice site probably benign
IGL03050:Myo5a UTSW 9 75,054,191 (GRCm39) splice site probably null
PIT4403001:Myo5a UTSW 9 75,124,805 (GRCm39) missense probably damaging 1.00
R0047:Myo5a UTSW 9 75,063,489 (GRCm39) missense probably damaging 1.00
R0047:Myo5a UTSW 9 75,063,489 (GRCm39) missense probably damaging 1.00
R0091:Myo5a UTSW 9 75,068,774 (GRCm39) missense probably damaging 1.00
R0142:Myo5a UTSW 9 75,067,856 (GRCm39) missense probably benign 0.01
R0243:Myo5a UTSW 9 75,093,405 (GRCm39) critical splice donor site probably null
R0395:Myo5a UTSW 9 75,101,259 (GRCm39) missense probably benign 0.39
R0427:Myo5a UTSW 9 75,081,478 (GRCm39) missense probably benign 0.00
R0545:Myo5a UTSW 9 75,074,319 (GRCm39) missense possibly damaging 0.94
R0565:Myo5a UTSW 9 75,087,394 (GRCm39) missense probably benign 0.00
R0601:Myo5a UTSW 9 75,081,297 (GRCm39) missense probably benign 0.01
R1457:Myo5a UTSW 9 75,120,347 (GRCm39) missense probably damaging 0.99
R1510:Myo5a UTSW 9 75,078,833 (GRCm39) missense probably benign
R1548:Myo5a UTSW 9 75,079,028 (GRCm39) missense probably damaging 1.00
R1759:Myo5a UTSW 9 75,089,275 (GRCm39) missense possibly damaging 0.72
R1924:Myo5a UTSW 9 75,023,489 (GRCm39) missense probably damaging 1.00
R1960:Myo5a UTSW 9 75,055,139 (GRCm39) missense probably damaging 1.00
R2050:Myo5a UTSW 9 75,054,156 (GRCm39) missense probably benign 0.01
R2070:Myo5a UTSW 9 75,089,266 (GRCm39) missense probably benign 0.03
R2075:Myo5a UTSW 9 75,097,200 (GRCm39) missense probably benign 0.01
R2148:Myo5a UTSW 9 75,087,429 (GRCm39) missense probably damaging 1.00
R2201:Myo5a UTSW 9 75,125,225 (GRCm39) missense possibly damaging 0.51
R2337:Myo5a UTSW 9 75,111,083 (GRCm39) missense probably damaging 1.00
R2357:Myo5a UTSW 9 75,108,647 (GRCm39) missense probably damaging 0.99
R2392:Myo5a UTSW 9 75,116,521 (GRCm39) missense probably benign 0.02
R2432:Myo5a UTSW 9 75,120,155 (GRCm39) missense possibly damaging 0.89
R2568:Myo5a UTSW 9 75,059,179 (GRCm39) missense probably damaging 1.00
R2568:Myo5a UTSW 9 75,030,322 (GRCm39) missense probably damaging 1.00
R2932:Myo5a UTSW 9 75,103,418 (GRCm39) missense possibly damaging 0.85
R2971:Myo5a UTSW 9 75,023,484 (GRCm39) missense probably damaging 1.00
R4231:Myo5a UTSW 9 75,097,279 (GRCm39) missense possibly damaging 0.67
R4293:Myo5a UTSW 9 75,051,453 (GRCm39) missense probably benign
R4321:Myo5a UTSW 9 75,124,812 (GRCm39) missense probably damaging 0.99
R4450:Myo5a UTSW 9 75,074,458 (GRCm39) missense probably benign 0.00
R4573:Myo5a UTSW 9 75,108,579 (GRCm39) splice site probably null
R4577:Myo5a UTSW 9 75,124,827 (GRCm39) missense probably damaging 1.00
R4601:Myo5a UTSW 9 75,043,670 (GRCm39) missense probably damaging 1.00
R4690:Myo5a UTSW 9 75,061,105 (GRCm39) missense probably damaging 0.99
R4691:Myo5a UTSW 9 75,087,438 (GRCm39) missense probably damaging 0.99
R4764:Myo5a UTSW 9 75,023,618 (GRCm39) intron probably benign
R4767:Myo5a UTSW 9 75,051,358 (GRCm39) missense probably damaging 0.99
R4829:Myo5a UTSW 9 75,043,689 (GRCm39) missense probably damaging 1.00
R4863:Myo5a UTSW 9 75,124,789 (GRCm39) missense probably damaging 1.00
R4902:Myo5a UTSW 9 75,081,360 (GRCm39) missense probably benign
R4947:Myo5a UTSW 9 75,030,330 (GRCm39) missense probably damaging 1.00
R5074:Myo5a UTSW 9 75,081,438 (GRCm39) missense probably benign
R5095:Myo5a UTSW 9 75,091,671 (GRCm39) nonsense probably null
R5095:Myo5a UTSW 9 75,059,302 (GRCm39) missense probably damaging 1.00
R5254:Myo5a UTSW 9 75,037,402 (GRCm39) missense probably damaging 1.00
R5267:Myo5a UTSW 9 75,059,292 (GRCm39) missense probably damaging 1.00
R5419:Myo5a UTSW 9 75,055,179 (GRCm39) missense probably damaging 1.00
R5514:Myo5a UTSW 9 75,061,048 (GRCm39) missense probably damaging 1.00
R5629:Myo5a UTSW 9 75,111,127 (GRCm39) missense possibly damaging 0.89
R5649:Myo5a UTSW 9 75,079,001 (GRCm39) missense possibly damaging 0.92
R5661:Myo5a UTSW 9 75,074,488 (GRCm39) missense probably benign 0.02
R5665:Myo5a UTSW 9 75,051,463 (GRCm39) critical splice donor site probably null
R5719:Myo5a UTSW 9 75,059,213 (GRCm39) missense probably damaging 1.00
R5964:Myo5a UTSW 9 75,111,115 (GRCm39) missense probably benign 0.09
R6014:Myo5a UTSW 9 75,074,489 (GRCm39) nonsense probably null
R6344:Myo5a UTSW 9 75,067,791 (GRCm39) missense probably benign 0.09
R6345:Myo5a UTSW 9 75,097,195 (GRCm39) missense possibly damaging 0.77
R6644:Myo5a UTSW 9 75,054,249 (GRCm39) missense probably damaging 0.98
R6712:Myo5a UTSW 9 75,120,182 (GRCm39) missense probably benign 0.12
R6838:Myo5a UTSW 9 75,061,165 (GRCm39) critical splice donor site probably null
R6866:Myo5a UTSW 9 75,047,970 (GRCm39) missense probably damaging 1.00
R6876:Myo5a UTSW 9 75,067,772 (GRCm39) missense probably benign 0.04
R7108:Myo5a UTSW 9 75,037,274 (GRCm39) missense probably damaging 1.00
R7159:Myo5a UTSW 9 75,078,845 (GRCm39) missense probably benign 0.07
R7164:Myo5a UTSW 9 75,087,435 (GRCm39) missense probably benign 0.00
R7219:Myo5a UTSW 9 75,028,052 (GRCm39) missense probably damaging 1.00
R7497:Myo5a UTSW 9 75,104,983 (GRCm39) missense
R7620:Myo5a UTSW 9 75,071,418 (GRCm39) missense probably benign 0.41
R7719:Myo5a UTSW 9 75,051,366 (GRCm39) missense probably benign 0.01
R7810:Myo5a UTSW 9 75,076,292 (GRCm39) missense probably benign
R7810:Myo5a UTSW 9 75,067,747 (GRCm39) missense probably benign 0.09
R7866:Myo5a UTSW 9 75,111,034 (GRCm39) missense probably damaging 1.00
R7939:Myo5a UTSW 9 75,097,182 (GRCm39) missense
R8050:Myo5a UTSW 9 75,089,228 (GRCm39) missense probably damaging 0.99
R8061:Myo5a UTSW 9 75,030,239 (GRCm39) nonsense probably null
R8326:Myo5a UTSW 9 75,125,271 (GRCm39) missense probably damaging 0.98
R8529:Myo5a UTSW 9 75,120,154 (GRCm39) missense probably benign 0.02
R8824:Myo5a UTSW 9 75,074,328 (GRCm39) missense probably damaging 1.00
R8858:Myo5a UTSW 9 75,091,965 (GRCm39) missense probably damaging 0.99
R9040:Myo5a UTSW 9 75,081,341 (GRCm39) missense probably benign 0.07
R9092:Myo5a UTSW 9 75,054,414 (GRCm39) critical splice donor site probably null
R9249:Myo5a UTSW 9 75,097,279 (GRCm39) missense possibly damaging 0.67
R9274:Myo5a UTSW 9 75,097,279 (GRCm39) missense possibly damaging 0.67
R9293:Myo5a UTSW 9 75,087,312 (GRCm39) missense probably benign 0.37
R9366:Myo5a UTSW 9 75,124,800 (GRCm39) missense probably damaging 0.98
R9410:Myo5a UTSW 9 75,023,496 (GRCm39) missense probably damaging 0.98
R9644:Myo5a UTSW 9 75,043,631 (GRCm39) missense probably damaging 1.00
R9649:Myo5a UTSW 9 75,099,726 (GRCm39) missense
R9748:Myo5a UTSW 9 75,091,965 (GRCm39) missense probably damaging 0.99
R9766:Myo5a UTSW 9 75,078,914 (GRCm39) missense probably damaging 0.99
X0010:Myo5a UTSW 9 75,093,187 (GRCm39) missense probably damaging 1.00
Z1177:Myo5a UTSW 9 75,093,318 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- CAGCATGTTTGTAGGGTTGAAGTAC -3'
(R):5'- CCTTTCCAGATGCTGAAATCCAG -3'

Sequencing Primer
(F):5'- ACAACCTTCTCATAGACTAAAAACC -3'
(R):5'- TTACAAGGTTGAGACACTAGTGCCAC -3'
Posted On 2016-02-04