Incidental Mutation 'R4811:Ust'
ID 369443
Institutional Source Beutler Lab
Gene Symbol Ust
Ensembl Gene ENSMUSG00000047712
Gene Name uronyl-2-sulfotransferase
Synonyms UA2OST, D930010O20Rik
MMRRC Submission 042430-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.444) question?
Stock # R4811 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 8080520-8394589 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 8121705 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 301 (H301L)
Ref Sequence ENSEMBL: ENSMUSP00000052017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061601]
AlphaFold Q8BUB6
Predicted Effect probably damaging
Transcript: ENSMUST00000061601
AA Change: H301L

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000052017
Gene: ENSMUSG00000047712
AA Change: H301L

DomainStartEndE-ValueType
Pfam:Gal-3-0_sulfotr 53 317 8.5e-11 PFAM
Pfam:Sulfotransfer_2 98 359 6.4e-38 PFAM
low complexity region 385 398 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219116
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Uronyl 2-sulfotransferase transfers sulfate to the 2-position of uronyl residues, such as iduronyl residues in dermatan sulfate and glucuronyl residues in chondroitin sulfate (Kobayashi et al., 1999 [PubMed 10187838]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447A16Rik G A 15: 37,425,952 (GRCm39) probably benign Het
Adam3 C T 8: 25,201,740 (GRCm39) G208R probably benign Het
Arsg G T 11: 109,424,898 (GRCm39) V290L probably benign Het
Cad A G 5: 31,232,034 (GRCm39) T104A probably benign Het
Ccdc180 A G 4: 45,928,020 (GRCm39) N1185S probably damaging Het
Cdh18 A G 15: 23,226,877 (GRCm39) T113A probably benign Het
Crocc2 G A 1: 93,133,618 (GRCm39) A967T probably damaging Het
Cyp4f16 A G 17: 32,764,080 (GRCm39) T291A probably benign Het
Dcc T A 18: 71,432,554 (GRCm39) H1300L probably benign Het
Ddx23 T A 15: 98,545,352 (GRCm39) probably null Het
Dnhd1 T G 7: 105,363,488 (GRCm39) S4017A probably damaging Het
Erbb4 A T 1: 68,293,703 (GRCm39) F729L probably damaging Het
Ercc6 G T 14: 32,296,886 (GRCm39) R1292L probably benign Het
Fam186b C T 15: 99,178,118 (GRCm39) V403M probably benign Het
Fam227a T C 15: 79,499,628 (GRCm39) N576D possibly damaging Het
Fbln1 A G 15: 85,111,167 (GRCm39) probably null Het
Fbxw17 T C 13: 50,579,669 (GRCm39) V162A probably benign Het
Gas2l1 A C 11: 5,014,436 (GRCm39) I8S probably damaging Het
Golgb1 T C 16: 36,711,781 (GRCm39) L195P probably damaging Het
Gps2 A T 11: 69,806,754 (GRCm39) H233L probably damaging Het
Guf1 T G 5: 69,721,852 (GRCm39) probably null Het
H2-T9 A G 17: 36,438,668 (GRCm39) L241S probably damaging Het
Il1rap T A 16: 26,519,988 (GRCm39) probably null Het
Ints14 A G 9: 64,871,800 (GRCm39) Y46C probably damaging Het
Kalrn T G 16: 34,177,339 (GRCm39) Q293H probably damaging Het
Kank2 A G 9: 21,687,043 (GRCm39) L593P probably damaging Het
Krt19 T C 11: 100,032,174 (GRCm39) T297A possibly damaging Het
Lcp1 T C 14: 75,437,848 (GRCm39) V86A probably damaging Het
Lins1 T A 7: 66,357,898 (GRCm39) I11K probably benign Het
Lrba T C 3: 86,683,448 (GRCm39) F2757L probably damaging Het
Lyst T C 13: 13,951,685 (GRCm39) I3762T probably benign Het
Lyzl6 A G 11: 103,525,851 (GRCm39) S90P possibly damaging Het
Mfsd2a T A 4: 122,853,175 (GRCm39) Q38L probably benign Het
Mtss1 A G 15: 58,815,922 (GRCm39) F546S probably damaging Het
Myo5a G A 9: 75,048,825 (GRCm39) probably null Het
Naip6 C A 13: 100,422,299 (GRCm39) G1245W probably damaging Het
Ndfip1 C T 18: 38,584,645 (GRCm39) T107I probably benign Het
Nek8 C T 11: 78,058,544 (GRCm39) probably null Het
Nphs1 T C 7: 30,159,854 (GRCm39) V55A probably damaging Het
Nrp2 C A 1: 62,758,240 (GRCm39) H75Q probably damaging Het
Oas1e C T 5: 120,933,448 (GRCm39) S39N probably damaging Het
Or13g1 T C 7: 85,956,166 (GRCm39) T52A probably benign Het
Or2y1e T G 11: 49,218,575 (GRCm39) S112R possibly damaging Het
Or5d37 A G 2: 87,923,876 (GRCm39) F135L probably benign Het
Or7h8 A T 9: 20,124,049 (GRCm39) I135F probably damaging Het
Pan3 T A 5: 147,466,868 (GRCm39) H632Q probably damaging Het
Paqr3 A C 5: 97,243,842 (GRCm39) S291A probably benign Het
Pcdh17 A C 14: 84,685,375 (GRCm39) D614A probably damaging Het
Pcyox1l T C 18: 61,830,606 (GRCm39) E422G possibly damaging Het
Pgr G T 9: 8,900,844 (GRCm39) E126* probably null Het
Pik3ap1 A G 19: 41,290,936 (GRCm39) V532A possibly damaging Het
Pla2g4c T C 7: 13,071,738 (GRCm39) I186T probably damaging Het
Pnkd G A 1: 74,388,564 (GRCm39) probably null Het
Poc1a A G 9: 106,226,908 (GRCm39) T334A probably damaging Het
Pou2f2 T A 7: 24,797,111 (GRCm39) K211* probably null Het
Rdh13 T C 7: 4,445,652 (GRCm39) E94G probably benign Het
Rnf186 A G 4: 138,694,498 (GRCm39) S13G probably benign Het
Ryr2 T C 13: 11,670,584 (GRCm39) R3471G probably damaging Het
Sbf2 T C 7: 109,971,742 (GRCm39) T831A probably damaging Het
Sh3gl2 A G 4: 85,316,403 (GRCm39) probably benign Het
Shoc1 T C 4: 59,082,404 (GRCm39) N408S probably benign Het
Snn T C 16: 10,890,397 (GRCm39) V72A probably benign Het
Sys1 T A 2: 164,306,344 (GRCm39) H99Q possibly damaging Het
Syt7 A G 19: 10,412,931 (GRCm39) K122R probably damaging Het
Tas1r2 T A 4: 139,396,311 (GRCm39) L550Q probably damaging Het
Tent5b T C 4: 133,213,681 (GRCm39) L184P probably benign Het
Thoc1 T C 18: 9,993,438 (GRCm39) I599T probably damaging Het
Tle3 C T 9: 61,281,279 (GRCm39) probably benign Het
Tll1 A C 8: 64,538,507 (GRCm39) V379G possibly damaging Het
Tnfrsf21 G A 17: 43,348,621 (GRCm39) E78K probably benign Het
Tpgs2 A G 18: 25,262,897 (GRCm39) probably benign Het
Trpm1 T C 7: 63,858,054 (GRCm39) L165P probably damaging Het
Trpm5 T C 7: 142,633,956 (GRCm39) Y750C probably damaging Het
Ttbk2 A C 2: 120,570,551 (GRCm39) S1201A possibly damaging Het
Vwa5a T C 9: 38,647,249 (GRCm39) F543L probably benign Het
Yeats2 T A 16: 19,971,645 (GRCm39) probably null Het
Zfp85 T C 13: 67,897,745 (GRCm39) Y109C probably damaging Het
Zfr2 T A 10: 81,079,547 (GRCm39) V362E probably benign Het
Znrf3 A T 11: 5,237,420 (GRCm39) C134S probably benign Het
Other mutations in Ust
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01992:Ust APN 10 8,173,842 (GRCm39) missense probably benign 0.09
IGL03056:Ust APN 10 8,083,326 (GRCm39) missense probably benign 0.01
R0015:Ust UTSW 10 8,205,829 (GRCm39) splice site probably benign
R0417:Ust UTSW 10 8,121,700 (GRCm39) missense probably damaging 1.00
R0423:Ust UTSW 10 8,173,912 (GRCm39) missense probably damaging 1.00
R0533:Ust UTSW 10 8,123,844 (GRCm39) splice site probably benign
R1344:Ust UTSW 10 8,173,954 (GRCm39) missense possibly damaging 0.82
R1436:Ust UTSW 10 8,183,202 (GRCm39) missense probably damaging 1.00
R1803:Ust UTSW 10 8,173,819 (GRCm39) critical splice donor site probably null
R2059:Ust UTSW 10 8,083,330 (GRCm39) missense probably damaging 1.00
R4248:Ust UTSW 10 8,393,982 (GRCm39) missense possibly damaging 0.67
R5075:Ust UTSW 10 8,393,988 (GRCm39) missense probably damaging 0.97
R5912:Ust UTSW 10 8,173,825 (GRCm39) missense probably benign 0.25
R5950:Ust UTSW 10 8,123,865 (GRCm39) missense probably benign 0.33
R7302:Ust UTSW 10 8,393,973 (GRCm39) missense probably damaging 0.99
R7478:Ust UTSW 10 8,266,650 (GRCm39) critical splice donor site probably null
R7685:Ust UTSW 10 8,083,339 (GRCm39) missense probably damaging 1.00
R7704:Ust UTSW 10 8,205,987 (GRCm39) missense probably benign 0.02
R9049:Ust UTSW 10 8,183,218 (GRCm39) nonsense probably null
R9425:Ust UTSW 10 8,205,873 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTAACCATGGTGAGTCTGG -3'
(R):5'- GTTGTTGCTGCACATCACAG -3'

Sequencing Primer
(F):5'- TGGAATTGAAAGCTCATGCCACTC -3'
(R):5'- GCACATCACAGGTCTTTGTGGTAAAG -3'
Posted On 2016-02-04