Incidental Mutation 'R4811:Nek8'
ID369449
Institutional Source Beutler Lab
Gene Symbol Nek8
Ensembl Gene ENSMUSG00000017405
Gene NameNIMA (never in mitosis gene a)-related expressed kinase 8
Synonyms
MMRRC Submission 042430-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.918) question?
Stock #R4811 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location78166106-78176675 bp(-) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) C to T at 78167718 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000017549 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017530] [ENSMUST00000017549] [ENSMUST00000148154]
Predicted Effect probably benign
Transcript: ENSMUST00000017530
SMART Domains Protein: ENSMUSP00000017530
Gene: ENSMUSG00000017386

DomainStartEndE-ValueType
RING 18 57 1.41e-4 SMART
Pfam:zf-TRAF 102 156 3.4e-19 PFAM
Pfam:zf-TRAF 156 210 4e-12 PFAM
Pfam:zf-TRAF 210 269 4.2e-23 PFAM
low complexity region 287 302 N/A INTRINSIC
MATH 312 445 1.04e-20 SMART
Predicted Effect probably null
Transcript: ENSMUST00000017549
SMART Domains Protein: ENSMUSP00000017549
Gene: ENSMUSG00000017405

DomainStartEndE-ValueType
S_TKc 4 258 1.59e-81 SMART
low complexity region 288 316 N/A INTRINSIC
low complexity region 364 378 N/A INTRINSIC
Pfam:RCC1 415 464 4.1e-12 PFAM
Pfam:RCC1_2 451 480 9.2e-10 PFAM
Pfam:RCC1 467 516 9.9e-16 PFAM
Pfam:RCC1 585 634 4.4e-15 PFAM
Pfam:RCC1 637 687 2e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125528
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131015
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141444
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142812
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147798
Predicted Effect probably benign
Transcript: ENSMUST00000148154
SMART Domains Protein: ENSMUSP00000127554
Gene: ENSMUSG00000017405

DomainStartEndE-ValueType
Pfam:Pkinase 1 103 4.1e-20 PFAM
Pfam:Pkinase_Tyr 1 103 3.2e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148218
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149437
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152611
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a NIMA-related kinase. Members of this serine/threonine protein kinase family are structurally-related to NIMA (never in mitosis, gene A) which controls mitotic signaling in Aspergillus nidulans. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice display kidney cysts primarily in the cortex, progressive kidney enlargement, increased serum creatinine levels, impaired maternal nurturing, and premature death. Heterotaxy with congenital heart disease such as hypoplastic right ventricle and small tricuspid valve is seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447A16Rik G A 15: 37,425,708 probably benign Het
Adam3 C T 8: 24,711,724 G208R probably benign Het
AI481877 T C 4: 59,082,404 N408S probably benign Het
Arsg G T 11: 109,534,072 V290L probably benign Het
Cad A G 5: 31,074,690 T104A probably benign Het
Ccdc180 A G 4: 45,928,020 N1185S probably damaging Het
Cdh18 A G 15: 23,226,791 T113A probably benign Het
Crocc2 G A 1: 93,205,896 A967T probably damaging Het
Cyp4f16 A G 17: 32,545,106 T291A probably benign Het
Dcc T A 18: 71,299,483 H1300L probably benign Het
Ddx23 T A 15: 98,647,471 probably null Het
Dnhd1 T G 7: 105,714,281 S4017A probably damaging Het
Erbb4 A T 1: 68,254,544 F729L probably damaging Het
Ercc6 G T 14: 32,574,929 R1292L probably benign Het
Fam186b C T 15: 99,280,237 V403M probably benign Het
Fam227a T C 15: 79,615,427 N576D possibly damaging Het
Fam46b T C 4: 133,486,370 L184P probably benign Het
Fbln1 A G 15: 85,226,966 probably null Het
Fbxw17 T C 13: 50,425,633 V162A probably benign Het
Gas2l1 A C 11: 5,064,436 I8S probably damaging Het
Gm7030 A G 17: 36,127,776 L241S probably damaging Het
Golgb1 T C 16: 36,891,419 L195P probably damaging Het
Gps2 A T 11: 69,915,928 H233L probably damaging Het
Guf1 T G 5: 69,564,509 probably null Het
Il1rap T A 16: 26,701,238 probably null Het
Ints14 A G 9: 64,964,518 Y46C probably damaging Het
Kalrn T G 16: 34,356,969 Q293H probably damaging Het
Kank2 A G 9: 21,775,747 L593P probably damaging Het
Krt19 T C 11: 100,141,348 T297A possibly damaging Het
Lcp1 T C 14: 75,200,408 V86A probably damaging Het
Lins1 T A 7: 66,708,150 I11K probably benign Het
Lrba T C 3: 86,776,141 F2757L probably damaging Het
Lyst T C 13: 13,777,100 I3762T probably benign Het
Lyzl6 A G 11: 103,635,025 S90P possibly damaging Het
Mfsd2a T A 4: 122,959,382 Q38L probably benign Het
Mtss1 A G 15: 58,944,073 F546S probably damaging Het
Myo5a G A 9: 75,141,543 probably null Het
Naip6 C A 13: 100,285,791 G1245W probably damaging Het
Ndfip1 C T 18: 38,451,592 T107I probably benign Het
Nphs1 T C 7: 30,460,429 V55A probably damaging Het
Nrp2 C A 1: 62,719,081 H75Q probably damaging Het
Oas1e C T 5: 120,795,383 S39N probably damaging Het
Olfr1164 A G 2: 88,093,532 F135L probably benign Het
Olfr1391 T G 11: 49,327,748 S112R possibly damaging Het
Olfr309 T C 7: 86,306,958 T52A probably benign Het
Olfr871 A T 9: 20,212,753 I135F probably damaging Het
Pan3 T A 5: 147,530,058 H632Q probably damaging Het
Paqr3 A C 5: 97,095,983 S291A probably benign Het
Pcdh17 A C 14: 84,447,935 D614A probably damaging Het
Pcyox1l T C 18: 61,697,535 E422G possibly damaging Het
Pgr G T 9: 8,900,843 E126* probably null Het
Pik3ap1 A G 19: 41,302,497 V532A possibly damaging Het
Pla2g4c T C 7: 13,337,813 I186T probably damaging Het
Pnkd G A 1: 74,349,405 probably null Het
Poc1a A G 9: 106,349,709 T334A probably damaging Het
Pou2f2 T A 7: 25,097,686 K211* probably null Het
Rdh13 T C 7: 4,442,653 E94G probably benign Het
Rnf186 A G 4: 138,967,187 S13G probably benign Het
Ryr2 T C 13: 11,655,698 R3471G probably damaging Het
Sbf2 T C 7: 110,372,535 T831A probably damaging Het
Sh3gl2 A G 4: 85,398,166 probably benign Het
Snn T C 16: 11,072,533 V72A probably benign Het
Sys1 T A 2: 164,464,424 H99Q possibly damaging Het
Syt7 A G 19: 10,435,567 K122R probably damaging Het
Tas1r2 T A 4: 139,669,000 L550Q probably damaging Het
Thoc1 T C 18: 9,993,438 I599T probably damaging Het
Tle3 C T 9: 61,373,997 probably benign Het
Tll1 A C 8: 64,085,473 V379G possibly damaging Het
Tnfrsf21 G A 17: 43,037,730 E78K probably benign Het
Tpgs2 A G 18: 25,129,840 probably benign Het
Trpm1 T C 7: 64,208,306 L165P probably damaging Het
Trpm5 T C 7: 143,080,219 Y750C probably damaging Het
Ttbk2 A C 2: 120,740,070 S1201A possibly damaging Het
Ust T A 10: 8,245,941 H301L probably damaging Het
Vwa5a T C 9: 38,735,953 F543L probably benign Het
Yeats2 T A 16: 20,152,895 probably null Het
Zfp85 T C 13: 67,749,626 Y109C probably damaging Het
Zfr2 T A 10: 81,243,713 V362E probably benign Het
Znrf3 A T 11: 5,287,420 C134S probably benign Het
Other mutations in Nek8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Nek8 APN 11 78167827 missense probably damaging 0.96
IGL00914:Nek8 APN 11 78173075 missense possibly damaging 0.80
nerkkod UTSW 11 78173059 missense probably damaging 1.00
R0136:Nek8 UTSW 11 78171207 missense probably benign 0.01
R0490:Nek8 UTSW 11 78167729 missense probably benign 0.01
R0657:Nek8 UTSW 11 78171207 missense probably benign 0.01
R1033:Nek8 UTSW 11 78171285 missense probably null 1.00
R2848:Nek8 UTSW 11 78168141 missense probably damaging 1.00
R3406:Nek8 UTSW 11 78170746 nonsense probably null
R4211:Nek8 UTSW 11 78170483 missense probably benign
R4810:Nek8 UTSW 11 78167803 missense probably benign 0.00
R5108:Nek8 UTSW 11 78172527 missense probably damaging 0.96
R5124:Nek8 UTSW 11 78172939 missense probably damaging 1.00
R5177:Nek8 UTSW 11 78170471 nonsense probably null
R5212:Nek8 UTSW 11 78172516 start codon destroyed probably null 0.02
R5386:Nek8 UTSW 11 78170437 splice site probably null
R5921:Nek8 UTSW 11 78173059 missense probably damaging 1.00
R5977:Nek8 UTSW 11 78167825 missense probably benign 0.01
R8010:Nek8 UTSW 11 78176596 missense probably damaging 1.00
R8195:Nek8 UTSW 11 78170761 missense possibly damaging 0.77
R8784:Nek8 UTSW 11 78172549 missense probably damaging 1.00
X0026:Nek8 UTSW 11 78168105 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ACCATCTTGATGCCCTCCAG -3'
(R):5'- AACTTCTGGCTCCATCCTTAGG -3'

Sequencing Primer
(F):5'- AGGCCTTGGACCCGACAG -3'
(R):5'- TCCTTAGGTTCAACAAGCTAGGC -3'
Posted On2016-02-04