Incidental Mutation 'R4811:Arsg'
ID369452
Institutional Source Beutler Lab
Gene Symbol Arsg
Ensembl Gene ENSMUSG00000020604
Gene Namearylsulfatase G
Synonyms6330406P08Rik
MMRRC Submission 042430-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4811 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location109473374-109573330 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 109534072 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 290 (V290L)
Ref Sequence ENSEMBL: ENSMUSP00000102308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020928] [ENSMUST00000106697]
Predicted Effect probably benign
Transcript: ENSMUST00000020928
AA Change: V290L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000020928
Gene: ENSMUSG00000020604
AA Change: V290L

DomainStartEndE-ValueType
Pfam:Sulfatase 36 378 2e-69 PFAM
Pfam:Sulfatase_C 401 522 2.9e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106697
AA Change: V290L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000102308
Gene: ENSMUSG00000020604
AA Change: V290L

DomainStartEndE-ValueType
Pfam:Sulfatase 36 378 2e-69 PFAM
Pfam:Sulfatase_C 401 522 4.7e-25 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the sulfatase enzyme family. Sulfatases hydrolyze sulfate esters from sulfated steroids, carbohydrates, proteoglycans, and glycolipids. They are involved in hormone biosynthesis, modulation of cell signaling, and degradation of macromolecules. This protein displays arylsulfatase activity at acidic pH, as is typical of lysosomal sulfatases, and has been shown to localize in the lysosomes. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for a null mutation display lysosomal storage pathology in the nervous system and peripheral tissues, including the liver and kidneys, resulting in Purkinje cell loss and age dependent cognitive impairment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447A16Rik G A 15: 37,425,708 probably benign Het
Adam3 C T 8: 24,711,724 G208R probably benign Het
AI481877 T C 4: 59,082,404 N408S probably benign Het
Cad A G 5: 31,074,690 T104A probably benign Het
Ccdc180 A G 4: 45,928,020 N1185S probably damaging Het
Cdh18 A G 15: 23,226,791 T113A probably benign Het
Crocc2 G A 1: 93,205,896 A967T probably damaging Het
Cyp4f16 A G 17: 32,545,106 T291A probably benign Het
Dcc T A 18: 71,299,483 H1300L probably benign Het
Ddx23 T A 15: 98,647,471 probably null Het
Dnhd1 T G 7: 105,714,281 S4017A probably damaging Het
Erbb4 A T 1: 68,254,544 F729L probably damaging Het
Ercc6 G T 14: 32,574,929 R1292L probably benign Het
Fam186b C T 15: 99,280,237 V403M probably benign Het
Fam227a T C 15: 79,615,427 N576D possibly damaging Het
Fam46b T C 4: 133,486,370 L184P probably benign Het
Fbln1 A G 15: 85,226,966 probably null Het
Fbxw17 T C 13: 50,425,633 V162A probably benign Het
Gas2l1 A C 11: 5,064,436 I8S probably damaging Het
Gm7030 A G 17: 36,127,776 L241S probably damaging Het
Golgb1 T C 16: 36,891,419 L195P probably damaging Het
Gps2 A T 11: 69,915,928 H233L probably damaging Het
Guf1 T G 5: 69,564,509 probably null Het
Il1rap T A 16: 26,701,238 probably null Het
Ints14 A G 9: 64,964,518 Y46C probably damaging Het
Kalrn T G 16: 34,356,969 Q293H probably damaging Het
Kank2 A G 9: 21,775,747 L593P probably damaging Het
Krt19 T C 11: 100,141,348 T297A possibly damaging Het
Lcp1 T C 14: 75,200,408 V86A probably damaging Het
Lins1 T A 7: 66,708,150 I11K probably benign Het
Lrba T C 3: 86,776,141 F2757L probably damaging Het
Lyst T C 13: 13,777,100 I3762T probably benign Het
Lyzl6 A G 11: 103,635,025 S90P possibly damaging Het
Mfsd2a T A 4: 122,959,382 Q38L probably benign Het
Mtss1 A G 15: 58,944,073 F546S probably damaging Het
Myo5a G A 9: 75,141,543 probably null Het
Naip6 C A 13: 100,285,791 G1245W probably damaging Het
Ndfip1 C T 18: 38,451,592 T107I probably benign Het
Nek8 C T 11: 78,167,718 probably null Het
Nphs1 T C 7: 30,460,429 V55A probably damaging Het
Nrp2 C A 1: 62,719,081 H75Q probably damaging Het
Oas1e C T 5: 120,795,383 S39N probably damaging Het
Olfr1164 A G 2: 88,093,532 F135L probably benign Het
Olfr1391 T G 11: 49,327,748 S112R possibly damaging Het
Olfr309 T C 7: 86,306,958 T52A probably benign Het
Olfr871 A T 9: 20,212,753 I135F probably damaging Het
Pan3 T A 5: 147,530,058 H632Q probably damaging Het
Paqr3 A C 5: 97,095,983 S291A probably benign Het
Pcdh17 A C 14: 84,447,935 D614A probably damaging Het
Pcyox1l T C 18: 61,697,535 E422G possibly damaging Het
Pgr G T 9: 8,900,843 E126* probably null Het
Pik3ap1 A G 19: 41,302,497 V532A possibly damaging Het
Pla2g4c T C 7: 13,337,813 I186T probably damaging Het
Pnkd G A 1: 74,349,405 probably null Het
Poc1a A G 9: 106,349,709 T334A probably damaging Het
Pou2f2 T A 7: 25,097,686 K211* probably null Het
Rdh13 T C 7: 4,442,653 E94G probably benign Het
Rnf186 A G 4: 138,967,187 S13G probably benign Het
Ryr2 T C 13: 11,655,698 R3471G probably damaging Het
Sbf2 T C 7: 110,372,535 T831A probably damaging Het
Sh3gl2 A G 4: 85,398,166 probably benign Het
Snn T C 16: 11,072,533 V72A probably benign Het
Sys1 T A 2: 164,464,424 H99Q possibly damaging Het
Syt7 A G 19: 10,435,567 K122R probably damaging Het
Tas1r2 T A 4: 139,669,000 L550Q probably damaging Het
Thoc1 T C 18: 9,993,438 I599T probably damaging Het
Tle3 C T 9: 61,373,997 probably benign Het
Tll1 A C 8: 64,085,473 V379G possibly damaging Het
Tnfrsf21 G A 17: 43,037,730 E78K probably benign Het
Tpgs2 A G 18: 25,129,840 probably benign Het
Trpm1 T C 7: 64,208,306 L165P probably damaging Het
Trpm5 T C 7: 143,080,219 Y750C probably damaging Het
Ttbk2 A C 2: 120,740,070 S1201A possibly damaging Het
Ust T A 10: 8,245,941 H301L probably damaging Het
Vwa5a T C 9: 38,735,953 F543L probably benign Het
Yeats2 T A 16: 20,152,895 probably null Het
Zfp85 T C 13: 67,749,626 Y109C probably damaging Het
Zfr2 T A 10: 81,243,713 V362E probably benign Het
Znrf3 A T 11: 5,287,420 C134S probably benign Het
Other mutations in Arsg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02093:Arsg APN 11 109525446 missense possibly damaging 0.88
IGL02257:Arsg APN 11 109521647 splice site probably benign
IGL03069:Arsg APN 11 109563256 missense probably damaging 1.00
R0421:Arsg UTSW 11 109527766 missense probably damaging 1.00
R1235:Arsg UTSW 11 109534107 critical splice donor site probably null
R1830:Arsg UTSW 11 109563274 critical splice donor site probably null
R2831:Arsg UTSW 11 109525449 missense possibly damaging 0.61
R4573:Arsg UTSW 11 109517282 missense probably damaging 1.00
R4780:Arsg UTSW 11 109534013 missense possibly damaging 0.80
R5510:Arsg UTSW 11 109527874 missense probably benign 0.33
R5861:Arsg UTSW 11 109563188 missense probably damaging 1.00
R5944:Arsg UTSW 11 109535311 missense probably damaging 0.99
R6502:Arsg UTSW 11 109517336 missense probably damaging 1.00
R6962:Arsg UTSW 11 109521669 missense probably damaging 1.00
X0019:Arsg UTSW 11 109563253 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TATTCCAGCACCAGTGGAAGAC -3'
(R):5'- TTCTTGTGACCGGATCTTGC -3'

Sequencing Primer
(F):5'- GCACCAGTGGAAGACCCTTC -3'
(R):5'- CTTGTGACCGGATCTTGCAGAAC -3'
Posted On2016-02-04