Mutagenetix > Incidental Mutation

Incidental Mutation 'R4811:Arsg'

369452

Institutional Source

Beutler Lab

Gene Symbol

Arsg

Ensembl Gene

ENSMUSG00000020604

Gene Name

arylsulfatase G

Synonyms

6330406P08Rik

MMRRC Submission

042430-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4811 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

109473374-109573330 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 109534072 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Leucine at position 290 (V290L)

Ref Sequence

ENSEMBL: ENSMUSP00000102308 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020928] [ENSMUST00000106697]

AlphaFold

Q3TYD4

Predicted Effect

probably benign
Transcript: ENSMUST00000020928
AA Change: V290L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000020928
Gene: ENSMUSG00000020604
AA Change: V290L

Domain	Start	End	E-Value	Type
Pfam:Sulfatase	36	378	2e-69	PFAM
Pfam:Sulfatase_C	401	522	2.9e-27	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000106697
AA Change: V290L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000102308
Gene: ENSMUSG00000020604
AA Change: V290L

Domain	Start	End	E-Value	Type
Pfam:Sulfatase	36	378	2e-69	PFAM
Pfam:Sulfatase_C	401	522	4.7e-25	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 93.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the sulfatase enzyme family. Sulfatases hydrolyze sulfate esters from sulfated steroids, carbohydrates, proteoglycans, and glycolipids. They are involved in hormone biosynthesis, modulation of cell signaling, and degradation of macromolecules. This protein displays arylsulfatase activity at acidic pH, as is typical of lysosomal sulfatases, and has been shown to localize in the lysosomes. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for a null mutation display lysosomal storage pathology in the nervous system and peripheral tissues, including the liver and kidneys, resulting in Purkinje cell loss and age dependent cognitive impairment. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930447A16Rik	G	A	15: 37,425,708		probably benign	Het
Adam3	C	T	8: 24,711,724	G208R	probably benign	Het
AI481877	T	C	4: 59,082,404	N408S	probably benign	Het
Cad	A	G	5: 31,074,690	T104A	probably benign	Het
Ccdc180	A	G	4: 45,928,020	N1185S	probably damaging	Het
Cdh18	A	G	15: 23,226,791	T113A	probably benign	Het
Crocc2	G	A	1: 93,205,896	A967T	probably damaging	Het
Cyp4f16	A	G	17: 32,545,106	T291A	probably benign	Het
Dcc	T	A	18: 71,299,483	H1300L	probably benign	Het
Ddx23	T	A	15: 98,647,471		probably null	Het
Dnhd1	T	G	7: 105,714,281	S4017A	probably damaging	Het
Erbb4	A	T	1: 68,254,544	F729L	probably damaging	Het
Ercc6	G	T	14: 32,574,929	R1292L	probably benign	Het
Fam186b	C	T	15: 99,280,237	V403M	probably benign	Het
Fam227a	T	C	15: 79,615,427	N576D	possibly damaging	Het
Fam46b	T	C	4: 133,486,370	L184P	probably benign	Het
Fbln1	A	G	15: 85,226,966		probably null	Het
Fbxw17	T	C	13: 50,425,633	V162A	probably benign	Het
Gas2l1	A	C	11: 5,064,436	I8S	probably damaging	Het
Gm7030	A	G	17: 36,127,776	L241S	probably damaging	Het
Golgb1	T	C	16: 36,891,419	L195P	probably damaging	Het
Gps2	A	T	11: 69,915,928	H233L	probably damaging	Het
Guf1	T	G	5: 69,564,509		probably null	Het
Il1rap	T	A	16: 26,701,238		probably null	Het
Ints14	A	G	9: 64,964,518	Y46C	probably damaging	Het
Kalrn	T	G	16: 34,356,969	Q293H	probably damaging	Het
Kank2	A	G	9: 21,775,747	L593P	probably damaging	Het
Krt19	T	C	11: 100,141,348	T297A	possibly damaging	Het
Lcp1	T	C	14: 75,200,408	V86A	probably damaging	Het
Lins1	T	A	7: 66,708,150	I11K	probably benign	Het
Lrba	T	C	3: 86,776,141	F2757L	probably damaging	Het
Lyst	T	C	13: 13,777,100	I3762T	probably benign	Het
Lyzl6	A	G	11: 103,635,025	S90P	possibly damaging	Het
Mfsd2a	T	A	4: 122,959,382	Q38L	probably benign	Het
Mtss1	A	G	15: 58,944,073	F546S	probably damaging	Het
Myo5a	G	A	9: 75,141,543		probably null	Het
Naip6	C	A	13: 100,285,791	G1245W	probably damaging	Het
Ndfip1	C	T	18: 38,451,592	T107I	probably benign	Het
Nek8	C	T	11: 78,167,718		probably null	Het
Nphs1	T	C	7: 30,460,429	V55A	probably damaging	Het
Nrp2	C	A	1: 62,719,081	H75Q	probably damaging	Het
Oas1e	C	T	5: 120,795,383	S39N	probably damaging	Het
Olfr1164	A	G	2: 88,093,532	F135L	probably benign	Het
Olfr1391	T	G	11: 49,327,748	S112R	possibly damaging	Het
Olfr309	T	C	7: 86,306,958	T52A	probably benign	Het
Olfr871	A	T	9: 20,212,753	I135F	probably damaging	Het
Pan3	T	A	5: 147,530,058	H632Q	probably damaging	Het
Paqr3	A	C	5: 97,095,983	S291A	probably benign	Het
Pcdh17	A	C	14: 84,447,935	D614A	probably damaging	Het
Pcyox1l	T	C	18: 61,697,535	E422G	possibly damaging	Het
Pgr	G	T	9: 8,900,843	E126*	probably null	Het
Pik3ap1	A	G	19: 41,302,497	V532A	possibly damaging	Het
Pla2g4c	T	C	7: 13,337,813	I186T	probably damaging	Het
Pnkd	G	A	1: 74,349,405		probably null	Het
Poc1a	A	G	9: 106,349,709	T334A	probably damaging	Het
Pou2f2	T	A	7: 25,097,686	K211*	probably null	Het
Rdh13	T	C	7: 4,442,653	E94G	probably benign	Het
Rnf186	A	G	4: 138,967,187	S13G	probably benign	Het
Ryr2	T	C	13: 11,655,698	R3471G	probably damaging	Het
Sbf2	T	C	7: 110,372,535	T831A	probably damaging	Het
Sh3gl2	A	G	4: 85,398,166		probably benign	Het
Snn	T	C	16: 11,072,533	V72A	probably benign	Het
Sys1	T	A	2: 164,464,424	H99Q	possibly damaging	Het
Syt7	A	G	19: 10,435,567	K122R	probably damaging	Het
Tas1r2	T	A	4: 139,669,000	L550Q	probably damaging	Het
Thoc1	T	C	18: 9,993,438	I599T	probably damaging	Het
Tle3	C	T	9: 61,373,997		probably benign	Het
Tll1	A	C	8: 64,085,473	V379G	possibly damaging	Het
Tnfrsf21	G	A	17: 43,037,730	E78K	probably benign	Het
Tpgs2	A	G	18: 25,129,840		probably benign	Het
Trpm1	T	C	7: 64,208,306	L165P	probably damaging	Het
Trpm5	T	C	7: 143,080,219	Y750C	probably damaging	Het
Ttbk2	A	C	2: 120,740,070	S1201A	possibly damaging	Het
Ust	T	A	10: 8,245,941	H301L	probably damaging	Het
Vwa5a	T	C	9: 38,735,953	F543L	probably benign	Het
Yeats2	T	A	16: 20,152,895		probably null	Het
Zfp85	T	C	13: 67,749,626	Y109C	probably damaging	Het
Zfr2	T	A	10: 81,243,713	V362E	probably benign	Het
Znrf3	A	T	11: 5,287,420	C134S	probably benign	Het

Other mutations in Arsg

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02093:Arsg	APN	11	109525446	missense	possibly damaging	0.88
IGL02257:Arsg	APN	11	109521647	splice site	probably benign
IGL03069:Arsg	APN	11	109563256	missense	probably damaging	1.00
R0421:Arsg	UTSW	11	109527766	missense	probably damaging	1.00
R1235:Arsg	UTSW	11	109534107	critical splice donor site	probably null
R1830:Arsg	UTSW	11	109563274	critical splice donor site	probably null
R2831:Arsg	UTSW	11	109525449	missense	possibly damaging	0.61
R4573:Arsg	UTSW	11	109517282	missense	probably damaging	1.00
R4780:Arsg	UTSW	11	109534013	missense	possibly damaging	0.80
R5510:Arsg	UTSW	11	109527874	missense	probably benign	0.33
R5861:Arsg	UTSW	11	109563188	missense	probably damaging	1.00
R5944:Arsg	UTSW	11	109535311	missense	probably damaging	0.99
R6502:Arsg	UTSW	11	109517336	missense	probably damaging	1.00
R6962:Arsg	UTSW	11	109521669	missense	probably damaging	1.00
R9005:Arsg	UTSW	11	109490520	missense	probably benign
R9240:Arsg	UTSW	11	109572267	missense	probably benign
R9748:Arsg	UTSW	11	109490626	missense	probably damaging	1.00
X0019:Arsg	UTSW	11	109563253	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TATTCCAGCACCAGTGGAAGAC -3'
(R):5'- TTCTTGTGACCGGATCTTGC -3'

Sequencing Primer
(F):5'- GCACCAGTGGAAGACCCTTC -3'
(R):5'- CTTGTGACCGGATCTTGCAGAAC -3'

Posted On

2016-02-04