Incidental Mutation 'R4811:Cdh18'
ID369464
Institutional Source Beutler Lab
Gene Symbol Cdh18
Ensembl Gene ENSMUSG00000040420
Gene Namecadherin 18
Synonyms
MMRRC Submission 042430-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R4811 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location22549022-23474418 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23226791 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 113 (T113A)
Ref Sequence ENSEMBL: ENSMUSP00000128643 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163361] [ENSMUST00000164787] [ENSMUST00000165614] [ENSMUST00000167623] [ENSMUST00000226693]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000040427
Predicted Effect probably benign
Transcript: ENSMUST00000163361
AA Change: T113A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129170
Gene: ENSMUSG00000040420
AA Change: T113A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
CA 76 157 4.24e-14 SMART
CA 181 266 1.37e-31 SMART
Pfam:Cadherin 273 337 2.8e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164787
AA Change: T113A

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000130851
Gene: ENSMUSG00000040420
AA Change: T113A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
CA 76 157 4.24e-14 SMART
CA 181 266 1.37e-31 SMART
CA 290 382 2.76e-13 SMART
CA 405 486 3.86e-26 SMART
CA 509 596 3.7e-5 SMART
transmembrane domain 614 636 N/A INTRINSIC
Pfam:Cadherin_C 639 783 6.8e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165614
AA Change: T113A

PolyPhen 2 Score 0.299 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000128643
Gene: ENSMUSG00000040420
AA Change: T113A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
CA 76 157 4.24e-14 SMART
CA 181 266 1.37e-31 SMART
CA 290 382 2.76e-13 SMART
CA 405 486 3.86e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167623
AA Change: T59A

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000128011
Gene: ENSMUSG00000040420
AA Change: T59A

DomainStartEndE-ValueType
CA 22 103 4.24e-14 SMART
CA 127 212 1.37e-31 SMART
CA 236 328 2.76e-13 SMART
CA 351 414 4.15e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226693
AA Change: T113A

PolyPhen 2 Score 0.254 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type II classical cadherin from the cadherin superfamily of integral membrane proteins that mediate calcium-dependent cell-cell adhesion. Mature cadherin proteins are composed of a large N-terminal extracellular domain, a single membrane-spanning domain, and a small, highly conserved C-terminal cytoplasmic domain. Type II (atypical) cadherins are defined based on their lack of a HAV cell adhesion recognition sequence specific to type I cadherins. This particular cadherin is expressed specifically in the central nervous system and is putatively involved in synaptic adhesion, axon outgrowth and guidance. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2014]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447A16Rik G A 15: 37,425,708 probably benign Het
Adam3 C T 8: 24,711,724 G208R probably benign Het
AI481877 T C 4: 59,082,404 N408S probably benign Het
Arsg G T 11: 109,534,072 V290L probably benign Het
Cad A G 5: 31,074,690 T104A probably benign Het
Ccdc180 A G 4: 45,928,020 N1185S probably damaging Het
Crocc2 G A 1: 93,205,896 A967T probably damaging Het
Cyp4f16 A G 17: 32,545,106 T291A probably benign Het
Dcc T A 18: 71,299,483 H1300L probably benign Het
Ddx23 T A 15: 98,647,471 probably null Het
Dnhd1 T G 7: 105,714,281 S4017A probably damaging Het
Erbb4 A T 1: 68,254,544 F729L probably damaging Het
Ercc6 G T 14: 32,574,929 R1292L probably benign Het
Fam186b C T 15: 99,280,237 V403M probably benign Het
Fam227a T C 15: 79,615,427 N576D possibly damaging Het
Fam46b T C 4: 133,486,370 L184P probably benign Het
Fbln1 A G 15: 85,226,966 probably null Het
Fbxw17 T C 13: 50,425,633 V162A probably benign Het
Gas2l1 A C 11: 5,064,436 I8S probably damaging Het
Gm7030 A G 17: 36,127,776 L241S probably damaging Het
Golgb1 T C 16: 36,891,419 L195P probably damaging Het
Gps2 A T 11: 69,915,928 H233L probably damaging Het
Guf1 T G 5: 69,564,509 probably null Het
Il1rap T A 16: 26,701,238 probably null Het
Ints14 A G 9: 64,964,518 Y46C probably damaging Het
Kalrn T G 16: 34,356,969 Q293H probably damaging Het
Kank2 A G 9: 21,775,747 L593P probably damaging Het
Krt19 T C 11: 100,141,348 T297A possibly damaging Het
Lcp1 T C 14: 75,200,408 V86A probably damaging Het
Lins1 T A 7: 66,708,150 I11K probably benign Het
Lrba T C 3: 86,776,141 F2757L probably damaging Het
Lyst T C 13: 13,777,100 I3762T probably benign Het
Lyzl6 A G 11: 103,635,025 S90P possibly damaging Het
Mfsd2a T A 4: 122,959,382 Q38L probably benign Het
Mtss1 A G 15: 58,944,073 F546S probably damaging Het
Myo5a G A 9: 75,141,543 probably null Het
Naip6 C A 13: 100,285,791 G1245W probably damaging Het
Ndfip1 C T 18: 38,451,592 T107I probably benign Het
Nek8 C T 11: 78,167,718 probably null Het
Nphs1 T C 7: 30,460,429 V55A probably damaging Het
Nrp2 C A 1: 62,719,081 H75Q probably damaging Het
Oas1e C T 5: 120,795,383 S39N probably damaging Het
Olfr1164 A G 2: 88,093,532 F135L probably benign Het
Olfr1391 T G 11: 49,327,748 S112R possibly damaging Het
Olfr309 T C 7: 86,306,958 T52A probably benign Het
Olfr871 A T 9: 20,212,753 I135F probably damaging Het
Pan3 T A 5: 147,530,058 H632Q probably damaging Het
Paqr3 A C 5: 97,095,983 S291A probably benign Het
Pcdh17 A C 14: 84,447,935 D614A probably damaging Het
Pcyox1l T C 18: 61,697,535 E422G possibly damaging Het
Pgr G T 9: 8,900,843 E126* probably null Het
Pik3ap1 A G 19: 41,302,497 V532A possibly damaging Het
Pla2g4c T C 7: 13,337,813 I186T probably damaging Het
Pnkd G A 1: 74,349,405 probably null Het
Poc1a A G 9: 106,349,709 T334A probably damaging Het
Pou2f2 T A 7: 25,097,686 K211* probably null Het
Rdh13 T C 7: 4,442,653 E94G probably benign Het
Rnf186 A G 4: 138,967,187 S13G probably benign Het
Ryr2 T C 13: 11,655,698 R3471G probably damaging Het
Sbf2 T C 7: 110,372,535 T831A probably damaging Het
Sh3gl2 A G 4: 85,398,166 probably benign Het
Snn T C 16: 11,072,533 V72A probably benign Het
Sys1 T A 2: 164,464,424 H99Q possibly damaging Het
Syt7 A G 19: 10,435,567 K122R probably damaging Het
Tas1r2 T A 4: 139,669,000 L550Q probably damaging Het
Thoc1 T C 18: 9,993,438 I599T probably damaging Het
Tle3 C T 9: 61,373,997 probably benign Het
Tll1 A C 8: 64,085,473 V379G possibly damaging Het
Tnfrsf21 G A 17: 43,037,730 E78K probably benign Het
Tpgs2 A G 18: 25,129,840 probably benign Het
Trpm1 T C 7: 64,208,306 L165P probably damaging Het
Trpm5 T C 7: 143,080,219 Y750C probably damaging Het
Ttbk2 A C 2: 120,740,070 S1201A possibly damaging Het
Ust T A 10: 8,245,941 H301L probably damaging Het
Vwa5a T C 9: 38,735,953 F543L probably benign Het
Yeats2 T A 16: 20,152,895 probably null Het
Zfp85 T C 13: 67,749,626 Y109C probably damaging Het
Zfr2 T A 10: 81,243,713 V362E probably benign Het
Znrf3 A T 11: 5,287,420 C134S probably benign Het
Other mutations in Cdh18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Cdh18 APN 15 23173796 missense probably damaging 0.97
IGL01663:Cdh18 APN 15 23445991 missense possibly damaging 0.92
IGL01758:Cdh18 APN 15 23474183 missense probably benign 0.20
IGL02192:Cdh18 APN 15 23460316 missense probably damaging 1.00
IGL02448:Cdh18 APN 15 23173789 missense probably benign 0.00
IGL02717:Cdh18 APN 15 23410715 nonsense probably null
IGL03241:Cdh18 APN 15 23226933 missense probably benign 0.19
IGL03268:Cdh18 APN 15 23366867 missense probably damaging 1.00
IGL03307:Cdh18 APN 15 23226786 missense probably damaging 1.00
R0316:Cdh18 UTSW 15 23366913 missense probably damaging 1.00
R0462:Cdh18 UTSW 15 23366885 missense probably damaging 1.00
R0607:Cdh18 UTSW 15 23410790 missense probably benign 0.01
R0761:Cdh18 UTSW 15 23226752 missense possibly damaging 0.87
R0973:Cdh18 UTSW 15 23473995 missense probably damaging 0.99
R1110:Cdh18 UTSW 15 23474317 missense probably benign 0.00
R1550:Cdh18 UTSW 15 23436548 missense probably damaging 1.00
R1656:Cdh18 UTSW 15 23474399 missense probably benign 0.38
R1682:Cdh18 UTSW 15 23400585 missense probably benign 0.05
R1770:Cdh18 UTSW 15 23474401 missense probably benign
R1829:Cdh18 UTSW 15 23173852 missense probably damaging 1.00
R2253:Cdh18 UTSW 15 23410805 missense probably benign 0.00
R2435:Cdh18 UTSW 15 23367008 missense probably damaging 1.00
R3914:Cdh18 UTSW 15 23410685 missense probably damaging 1.00
R3964:Cdh18 UTSW 15 23474101 missense probably benign
R4002:Cdh18 UTSW 15 23382962 missense possibly damaging 0.48
R4291:Cdh18 UTSW 15 22714551 intron probably benign
R4581:Cdh18 UTSW 15 23226783 missense probably damaging 1.00
R4604:Cdh18 UTSW 15 23474368 missense probably benign 0.05
R4625:Cdh18 UTSW 15 22714042 intron probably benign
R4786:Cdh18 UTSW 15 23410787 missense probably null 1.00
R5023:Cdh18 UTSW 15 23259666 missense probably damaging 1.00
R5094:Cdh18 UTSW 15 22714539 intron probably benign
R5278:Cdh18 UTSW 15 23474158 missense probably benign 0.04
R5416:Cdh18 UTSW 15 23226723 missense probably damaging 1.00
R5503:Cdh18 UTSW 15 23436534 missense probably damaging 0.96
R5617:Cdh18 UTSW 15 23226768 missense probably damaging 0.97
R5982:Cdh18 UTSW 15 23474216 missense possibly damaging 0.89
R6240:Cdh18 UTSW 15 23226936 missense possibly damaging 0.82
R6475:Cdh18 UTSW 15 23226936 missense possibly damaging 0.82
R6649:Cdh18 UTSW 15 23436534 missense possibly damaging 0.87
R6700:Cdh18 UTSW 15 23474105 missense probably benign
R6718:Cdh18 UTSW 15 23226749 missense probably benign 0.15
R6796:Cdh18 UTSW 15 23446073 missense probably damaging 1.00
R7330:Cdh18 UTSW 15 23226950 missense possibly damaging 0.46
R7429:Cdh18 UTSW 15 23366856 missense possibly damaging 0.89
R7477:Cdh18 UTSW 15 23410725 missense probably benign
R7516:Cdh18 UTSW 15 23259598 splice site probably null
R7519:Cdh18 UTSW 15 23474212 missense possibly damaging 0.68
R7575:Cdh18 UTSW 15 23400597 nonsense probably null
R7618:Cdh18 UTSW 15 23366970 missense probably damaging 1.00
R7844:Cdh18 UTSW 15 23410787 missense probably damaging 1.00
R7870:Cdh18 UTSW 15 23474327 missense possibly damaging 0.94
R8288:Cdh18 UTSW 15 23445987 missense probably damaging 1.00
R8420:Cdh18 UTSW 15 23474052 missense possibly damaging 0.94
R8430:Cdh18 UTSW 15 23226684 missense probably damaging 1.00
R8916:Cdh18 UTSW 15 23410727 missense not run
Z1189:Cdh18 UTSW 15 23474283 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- CTATAGCATGAGGTTTCCAGTAAAG -3'
(R):5'- TTCAGGCACAGTAACGATGTATG -3'

Sequencing Primer
(F):5'- TTCTAGCTGCACTCCAAC -3'
(R):5'- GCACAGTAACGATGTATGGTCCATC -3'
Posted On2016-02-04