Incidental Mutation 'R4811:Yeats2'
ID369472
Institutional Source Beutler Lab
Gene Symbol Yeats2
Ensembl Gene ENSMUSG00000041215
Gene NameYEATS domain containing 2
Synonyms
MMRRC Submission 042430-MU
Accession Numbers

Ncbi RefSeq: NM_001145930.1, NM_001033237.2, NM_001145931.1; MGI:2447762

Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R4811 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location20141063-20232573 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 20152895 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155892 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090052] [ENSMUST00000115560] [ENSMUST00000231705] [ENSMUST00000232019] [ENSMUST00000232019] [ENSMUST00000232338]
Predicted Effect probably null
Transcript: ENSMUST00000090052
SMART Domains Protein: ENSMUSP00000087506
Gene: ENSMUSG00000041215

DomainStartEndE-ValueType
Pfam:YEATS 179 262 2.6e-27 PFAM
low complexity region 299 309 N/A INTRINSIC
low complexity region 312 333 N/A INTRINSIC
low complexity region 409 429 N/A INTRINSIC
low complexity region 458 467 N/A INTRINSIC
internal_repeat_1 471 675 3.72e-6 PROSPERO
low complexity region 683 702 N/A INTRINSIC
low complexity region 738 775 N/A INTRINSIC
internal_repeat_1 785 978 3.72e-6 PROSPERO
low complexity region 1240 1249 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115560
SMART Domains Protein: ENSMUSP00000111222
Gene: ENSMUSG00000041215

DomainStartEndE-ValueType
Pfam:YEATS 232 314 2.1e-28 PFAM
low complexity region 352 362 N/A INTRINSIC
low complexity region 365 386 N/A INTRINSIC
low complexity region 462 482 N/A INTRINSIC
low complexity region 511 520 N/A INTRINSIC
internal_repeat_1 524 728 4.68e-6 PROSPERO
low complexity region 736 755 N/A INTRINSIC
low complexity region 791 828 N/A INTRINSIC
internal_repeat_1 838 1031 4.68e-6 PROSPERO
low complexity region 1293 1302 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000231705
Predicted Effect probably null
Transcript: ENSMUST00000232019
Predicted Effect probably null
Transcript: ENSMUST00000232019
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232172
Predicted Effect probably benign
Transcript: ENSMUST00000232338
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] YEATS2 is a scaffolding subunit of the ADA2A (TADA2A; MIM 602276)-containing (ATAC) histone acetyltransferase complex (Wang et al., 2008 [PubMed 18838386]).[supplied by OMIM, Apr 2010]
Allele List at MGI

All alleles(34) : Targeted(1) Gene trapped(33)

Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447A16Rik G A 15: 37,425,708 probably benign Het
Adam3 C T 8: 24,711,724 G208R probably benign Het
AI481877 T C 4: 59,082,404 N408S probably benign Het
Arsg G T 11: 109,534,072 V290L probably benign Het
Cad A G 5: 31,074,690 T104A probably benign Het
Ccdc180 A G 4: 45,928,020 N1185S probably damaging Het
Cdh18 A G 15: 23,226,791 T113A probably benign Het
Crocc2 G A 1: 93,205,896 A967T probably damaging Het
Cyp4f16 A G 17: 32,545,106 T291A probably benign Het
Dcc T A 18: 71,299,483 H1300L probably benign Het
Ddx23 T A 15: 98,647,471 probably null Het
Dnhd1 T G 7: 105,714,281 S4017A probably damaging Het
Erbb4 A T 1: 68,254,544 F729L probably damaging Het
Ercc6 G T 14: 32,574,929 R1292L probably benign Het
Fam186b C T 15: 99,280,237 V403M probably benign Het
Fam227a T C 15: 79,615,427 N576D possibly damaging Het
Fam46b T C 4: 133,486,370 L184P probably benign Het
Fbln1 A G 15: 85,226,966 probably null Het
Fbxw17 T C 13: 50,425,633 V162A probably benign Het
Gas2l1 A C 11: 5,064,436 I8S probably damaging Het
Gm7030 A G 17: 36,127,776 L241S probably damaging Het
Golgb1 T C 16: 36,891,419 L195P probably damaging Het
Gps2 A T 11: 69,915,928 H233L probably damaging Het
Guf1 T G 5: 69,564,509 probably null Het
Il1rap T A 16: 26,701,238 probably null Het
Ints14 A G 9: 64,964,518 Y46C probably damaging Het
Kalrn T G 16: 34,356,969 Q293H probably damaging Het
Kank2 A G 9: 21,775,747 L593P probably damaging Het
Krt19 T C 11: 100,141,348 T297A possibly damaging Het
Lcp1 T C 14: 75,200,408 V86A probably damaging Het
Lins1 T A 7: 66,708,150 I11K probably benign Het
Lrba T C 3: 86,776,141 F2757L probably damaging Het
Lyst T C 13: 13,777,100 I3762T probably benign Het
Lyzl6 A G 11: 103,635,025 S90P possibly damaging Het
Mfsd2a T A 4: 122,959,382 Q38L probably benign Het
Mtss1 A G 15: 58,944,073 F546S probably damaging Het
Myo5a G A 9: 75,141,543 probably null Het
Naip6 C A 13: 100,285,791 G1245W probably damaging Het
Ndfip1 C T 18: 38,451,592 T107I probably benign Het
Nek8 C T 11: 78,167,718 probably null Het
Nphs1 T C 7: 30,460,429 V55A probably damaging Het
Nrp2 C A 1: 62,719,081 H75Q probably damaging Het
Oas1e C T 5: 120,795,383 S39N probably damaging Het
Olfr1164 A G 2: 88,093,532 F135L probably benign Het
Olfr1391 T G 11: 49,327,748 S112R possibly damaging Het
Olfr309 T C 7: 86,306,958 T52A probably benign Het
Olfr871 A T 9: 20,212,753 I135F probably damaging Het
Pan3 T A 5: 147,530,058 H632Q probably damaging Het
Paqr3 A C 5: 97,095,983 S291A probably benign Het
Pcdh17 A C 14: 84,447,935 D614A probably damaging Het
Pcyox1l T C 18: 61,697,535 E422G possibly damaging Het
Pgr G T 9: 8,900,843 E126* probably null Het
Pik3ap1 A G 19: 41,302,497 V532A possibly damaging Het
Pla2g4c T C 7: 13,337,813 I186T probably damaging Het
Pnkd G A 1: 74,349,405 probably null Het
Poc1a A G 9: 106,349,709 T334A probably damaging Het
Pou2f2 T A 7: 25,097,686 K211* probably null Het
Rdh13 T C 7: 4,442,653 E94G probably benign Het
Rnf186 A G 4: 138,967,187 S13G probably benign Het
Ryr2 T C 13: 11,655,698 R3471G probably damaging Het
Sbf2 T C 7: 110,372,535 T831A probably damaging Het
Sh3gl2 A G 4: 85,398,166 probably benign Het
Snn T C 16: 11,072,533 V72A probably benign Het
Sys1 T A 2: 164,464,424 H99Q possibly damaging Het
Syt7 A G 19: 10,435,567 K122R probably damaging Het
Tas1r2 T A 4: 139,669,000 L550Q probably damaging Het
Thoc1 T C 18: 9,993,438 I599T probably damaging Het
Tle3 C T 9: 61,373,997 probably benign Het
Tll1 A C 8: 64,085,473 V379G possibly damaging Het
Tnfrsf21 G A 17: 43,037,730 E78K probably benign Het
Tpgs2 A G 18: 25,129,840 probably benign Het
Trpm1 T C 7: 64,208,306 L165P probably damaging Het
Trpm5 T C 7: 143,080,219 Y750C probably damaging Het
Ttbk2 A C 2: 120,740,070 S1201A possibly damaging Het
Ust T A 10: 8,245,941 H301L probably damaging Het
Vwa5a T C 9: 38,735,953 F543L probably benign Het
Zfp85 T C 13: 67,749,626 Y109C probably damaging Het
Zfr2 T A 10: 81,243,713 V362E probably benign Het
Znrf3 A T 11: 5,287,420 C134S probably benign Het
Other mutations in Yeats2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01118:Yeats2 APN 16 20186304 missense probably damaging 0.99
IGL01128:Yeats2 APN 16 20161968 splice site probably benign
IGL01139:Yeats2 APN 16 20214393 missense probably damaging 1.00
IGL01394:Yeats2 APN 16 20162032 missense probably damaging 0.99
IGL01482:Yeats2 APN 16 20222921 missense probably damaging 1.00
IGL01924:Yeats2 APN 16 20206167 missense probably damaging 1.00
IGL01925:Yeats2 APN 16 20179680 splice site probably benign
IGL02106:Yeats2 APN 16 20193220 missense possibly damaging 0.79
IGL02370:Yeats2 APN 16 20150471 missense probably damaging 0.99
IGL02447:Yeats2 APN 16 20193679 missense probably benign 0.00
IGL02669:Yeats2 APN 16 20186283 missense probably benign 0.13
IGL03155:Yeats2 APN 16 20229573 critical splice donor site probably null
tyrion UTSW 16 20213401 splice site probably benign
P0045:Yeats2 UTSW 16 20156945 missense possibly damaging 0.47
R0051:Yeats2 UTSW 16 20193724 nonsense probably null
R0051:Yeats2 UTSW 16 20193724 nonsense probably null
R0118:Yeats2 UTSW 16 20156942 nonsense probably null
R0157:Yeats2 UTSW 16 20221677 makesense probably null
R0184:Yeats2 UTSW 16 20203685 missense possibly damaging 0.79
R0194:Yeats2 UTSW 16 20152969 start codon destroyed probably null 1.00
R0612:Yeats2 UTSW 16 20186425 missense probably benign 0.00
R0655:Yeats2 UTSW 16 20193824 nonsense probably null
R0826:Yeats2 UTSW 16 20193216 nonsense probably null
R1526:Yeats2 UTSW 16 20206086 missense probably damaging 1.00
R1535:Yeats2 UTSW 16 20189365 missense probably damaging 0.99
R1749:Yeats2 UTSW 16 20186268 nonsense probably null
R1842:Yeats2 UTSW 16 20171238 missense probably damaging 1.00
R1843:Yeats2 UTSW 16 20229564 missense probably benign 0.01
R1926:Yeats2 UTSW 16 20214426 missense probably benign
R2000:Yeats2 UTSW 16 20186391 missense probably benign 0.20
R2017:Yeats2 UTSW 16 20159181 missense probably benign 0.01
R2076:Yeats2 UTSW 16 20186282 missense possibly damaging 0.47
R2153:Yeats2 UTSW 16 20154166 missense probably damaging 1.00
R2167:Yeats2 UTSW 16 20213401 splice site probably benign
R2981:Yeats2 UTSW 16 20186301 missense probably damaging 0.99
R3160:Yeats2 UTSW 16 20193645 missense probably damaging 1.00
R3161:Yeats2 UTSW 16 20193645 missense probably damaging 1.00
R3162:Yeats2 UTSW 16 20193645 missense probably damaging 1.00
R3774:Yeats2 UTSW 16 20150495 missense probably damaging 1.00
R4250:Yeats2 UTSW 16 20156935 missense possibly damaging 0.90
R4305:Yeats2 UTSW 16 20208422 missense probably damaging 1.00
R4455:Yeats2 UTSW 16 20161993 missense possibly damaging 0.88
R4458:Yeats2 UTSW 16 20213321 missense probably damaging 0.99
R4902:Yeats2 UTSW 16 20207668 missense probably benign 0.00
R5043:Yeats2 UTSW 16 20208465 missense probably damaging 1.00
R5047:Yeats2 UTSW 16 20208465 missense probably damaging 1.00
R5319:Yeats2 UTSW 16 20186425 missense probably benign 0.01
R5328:Yeats2 UTSW 16 20171205 missense probably damaging 1.00
R5360:Yeats2 UTSW 16 20154162 missense probably damaging 0.97
R5416:Yeats2 UTSW 16 20211569 missense probably benign 0.01
R5672:Yeats2 UTSW 16 20162029 missense probably damaging 1.00
R5684:Yeats2 UTSW 16 20193803 missense possibly damaging 0.94
R5932:Yeats2 UTSW 16 20193163 missense probably benign 0.06
R5946:Yeats2 UTSW 16 20207763 nonsense probably null
R6168:Yeats2 UTSW 16 20179558 missense probably benign 0.01
R6169:Yeats2 UTSW 16 20219667 missense probably damaging 1.00
R6179:Yeats2 UTSW 16 20214475 missense probably benign 0.16
R6371:Yeats2 UTSW 16 20221710 missense possibly damaging 0.54
R6877:Yeats2 UTSW 16 20179594 missense probably benign 0.00
R7149:Yeats2 UTSW 16 20154189 missense probably damaging 1.00
R7405:Yeats2 UTSW 16 20222913 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTATCTTACAGTTTCATGCAGATG -3'
(R):5'- TATCTGGGGATGGAAGTTCAAG -3'

Sequencing Primer
(F):5'- GGCTATTGTGTGATGAACTC -3'
(R):5'- AAGATTCATGTGCTCCAGGC -3'
Posted On2016-02-04