Mutagenetix > Incidental Mutation

Incidental Mutation 'R4811:Tnfrsf21'

369479

Institutional Source

Beutler Lab

Gene Symbol

Tnfrsf21

Ensembl Gene

ENSMUSG00000023915

Gene Name

tumor necrosis factor receptor superfamily, member 21

Synonyms

DR6, TR7, Death receptor 6

MMRRC Submission

042430-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.200) question?

Stock #

R4811 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

43016555-43089188 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 43037730 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 78 (E78K)

Ref Sequence

ENSEMBL: ENSMUSP00000024708 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024708]

AlphaFold

Q9EPU5

Predicted Effect

probably benign
Transcript: ENSMUST00000024708
AA Change: E78K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000024708
Gene: ENSMUSG00000023915
AA Change: E78K

Domain	Start	End	E-Value	Type
TNFR	50	88	1.58e1	SMART
TNFR	91	131	3.42e-3	SMART
TNFR	133	168	9.31e-5	SMART
TNFR	171	211	1.1e-1	SMART
transmembrane domain	351	370	N/A	INTRINSIC
DEATH	393	498	1.41e-22	SMART
low complexity region	511	526	N/A	INTRINSIC
low complexity region	562	575	N/A	INTRINSIC
PDB:2DBH\|A	576	655	5e-48	PDB

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 93.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tumor necrosis factor receptor superfamily. The encoded protein activates nuclear factor kappa-B and mitogen-activated protein kinase 8 (also called c-Jun N-terminal kinase 1), and induces cell apoptosis. Through its death domain, the encoded receptor interacts with tumor necrosis factor receptor type 1-associated death domain (TRADD) protein, which is known to mediate signal transduction of tumor necrosis factor receptors. Knockout studies in mice suggest that this gene plays a role in T-helper cell activation, and may be involved in inflammation and immune regulation. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired T cell differentiation and an enhanced Th2 response. Mice homozygous for a different knock-out allele show increased CD4+ T cell proliferation and Th2 cytokine production, and enhanced B cell proliferation, survival, and humoral responses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930447A16Rik	G	A	15: 37,425,708		probably benign	Het
Adam3	C	T	8: 24,711,724	G208R	probably benign	Het
AI481877	T	C	4: 59,082,404	N408S	probably benign	Het
Arsg	G	T	11: 109,534,072	V290L	probably benign	Het
Cad	A	G	5: 31,074,690	T104A	probably benign	Het
Ccdc180	A	G	4: 45,928,020	N1185S	probably damaging	Het
Cdh18	A	G	15: 23,226,791	T113A	probably benign	Het
Crocc2	G	A	1: 93,205,896	A967T	probably damaging	Het
Cyp4f16	A	G	17: 32,545,106	T291A	probably benign	Het
Dcc	T	A	18: 71,299,483	H1300L	probably benign	Het
Ddx23	T	A	15: 98,647,471		probably null	Het
Dnhd1	T	G	7: 105,714,281	S4017A	probably damaging	Het
Erbb4	A	T	1: 68,254,544	F729L	probably damaging	Het
Ercc6	G	T	14: 32,574,929	R1292L	probably benign	Het
Fam186b	C	T	15: 99,280,237	V403M	probably benign	Het
Fam227a	T	C	15: 79,615,427	N576D	possibly damaging	Het
Fam46b	T	C	4: 133,486,370	L184P	probably benign	Het
Fbln1	A	G	15: 85,226,966		probably null	Het
Fbxw17	T	C	13: 50,425,633	V162A	probably benign	Het
Gas2l1	A	C	11: 5,064,436	I8S	probably damaging	Het
Gm7030	A	G	17: 36,127,776	L241S	probably damaging	Het
Golgb1	T	C	16: 36,891,419	L195P	probably damaging	Het
Gps2	A	T	11: 69,915,928	H233L	probably damaging	Het
Guf1	T	G	5: 69,564,509		probably null	Het
Il1rap	T	A	16: 26,701,238		probably null	Het
Ints14	A	G	9: 64,964,518	Y46C	probably damaging	Het
Kalrn	T	G	16: 34,356,969	Q293H	probably damaging	Het
Kank2	A	G	9: 21,775,747	L593P	probably damaging	Het
Krt19	T	C	11: 100,141,348	T297A	possibly damaging	Het
Lcp1	T	C	14: 75,200,408	V86A	probably damaging	Het
Lins1	T	A	7: 66,708,150	I11K	probably benign	Het
Lrba	T	C	3: 86,776,141	F2757L	probably damaging	Het
Lyst	T	C	13: 13,777,100	I3762T	probably benign	Het
Lyzl6	A	G	11: 103,635,025	S90P	possibly damaging	Het
Mfsd2a	T	A	4: 122,959,382	Q38L	probably benign	Het
Mtss1	A	G	15: 58,944,073	F546S	probably damaging	Het
Myo5a	G	A	9: 75,141,543		probably null	Het
Naip6	C	A	13: 100,285,791	G1245W	probably damaging	Het
Ndfip1	C	T	18: 38,451,592	T107I	probably benign	Het
Nek8	C	T	11: 78,167,718		probably null	Het
Nphs1	T	C	7: 30,460,429	V55A	probably damaging	Het
Nrp2	C	A	1: 62,719,081	H75Q	probably damaging	Het
Oas1e	C	T	5: 120,795,383	S39N	probably damaging	Het
Olfr1164	A	G	2: 88,093,532	F135L	probably benign	Het
Olfr1391	T	G	11: 49,327,748	S112R	possibly damaging	Het
Olfr309	T	C	7: 86,306,958	T52A	probably benign	Het
Olfr871	A	T	9: 20,212,753	I135F	probably damaging	Het
Pan3	T	A	5: 147,530,058	H632Q	probably damaging	Het
Paqr3	A	C	5: 97,095,983	S291A	probably benign	Het
Pcdh17	A	C	14: 84,447,935	D614A	probably damaging	Het
Pcyox1l	T	C	18: 61,697,535	E422G	possibly damaging	Het
Pgr	G	T	9: 8,900,843	E126*	probably null	Het
Pik3ap1	A	G	19: 41,302,497	V532A	possibly damaging	Het
Pla2g4c	T	C	7: 13,337,813	I186T	probably damaging	Het
Pnkd	G	A	1: 74,349,405		probably null	Het
Poc1a	A	G	9: 106,349,709	T334A	probably damaging	Het
Pou2f2	T	A	7: 25,097,686	K211*	probably null	Het
Rdh13	T	C	7: 4,442,653	E94G	probably benign	Het
Rnf186	A	G	4: 138,967,187	S13G	probably benign	Het
Ryr2	T	C	13: 11,655,698	R3471G	probably damaging	Het
Sbf2	T	C	7: 110,372,535	T831A	probably damaging	Het
Sh3gl2	A	G	4: 85,398,166		probably benign	Het
Snn	T	C	16: 11,072,533	V72A	probably benign	Het
Sys1	T	A	2: 164,464,424	H99Q	possibly damaging	Het
Syt7	A	G	19: 10,435,567	K122R	probably damaging	Het
Tas1r2	T	A	4: 139,669,000	L550Q	probably damaging	Het
Thoc1	T	C	18: 9,993,438	I599T	probably damaging	Het
Tle3	C	T	9: 61,373,997		probably benign	Het
Tll1	A	C	8: 64,085,473	V379G	possibly damaging	Het
Tpgs2	A	G	18: 25,129,840		probably benign	Het
Trpm1	T	C	7: 64,208,306	L165P	probably damaging	Het
Trpm5	T	C	7: 143,080,219	Y750C	probably damaging	Het
Ttbk2	A	C	2: 120,740,070	S1201A	possibly damaging	Het
Ust	T	A	10: 8,245,941	H301L	probably damaging	Het
Vwa5a	T	C	9: 38,735,953	F543L	probably benign	Het
Yeats2	T	A	16: 20,152,895		probably null	Het
Zfp85	T	C	13: 67,749,626	Y109C	probably damaging	Het
Zfr2	T	A	10: 81,243,713	V362E	probably benign	Het
Znrf3	A	T	11: 5,287,420	C134S	probably benign	Het

Other mutations in Tnfrsf21

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01406:Tnfrsf21	APN	17	43037946	missense	probably damaging	1.00
IGL01663:Tnfrsf21	APN	17	43087811	missense	probably benign	0.13
IGL01811:Tnfrsf21	APN	17	43037613	missense	probably benign
IGL01916:Tnfrsf21	APN	17	43039803	missense	probably benign	0.00
IGL01934:Tnfrsf21	APN	17	43065187	missense	probably benign	0.15
IGL02184:Tnfrsf21	APN	17	43085463	missense	probably benign	0.37
IGL02292:Tnfrsf21	APN	17	43039911	missense	probably benign
IGL02385:Tnfrsf21	APN	17	43040051	missense	probably damaging	1.00
IGL02710:Tnfrsf21	APN	17	43087929	missense	probably damaging	0.97
IGL03001:Tnfrsf21	APN	17	43087895	missense	probably damaging	0.99
IGL03003:Tnfrsf21	APN	17	43039943	missense	probably damaging	1.00
PIT4480001:Tnfrsf21	UTSW	17	43037911	missense	probably benign	0.00
R0007:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0046:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0088:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0091:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0102:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0102:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0103:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0105:Tnfrsf21	UTSW	17	43040191	critical splice donor site	probably null
R0105:Tnfrsf21	UTSW	17	43040191	critical splice donor site	probably null
R0206:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0211:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0240:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0243:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0308:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0363:Tnfrsf21	UTSW	17	43037877	missense	probably benign	0.01
R0456:Tnfrsf21	UTSW	17	43038091	missense	probably benign	0.01
R0522:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0523:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0525:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0528:Tnfrsf21	UTSW	17	43037614	missense	probably benign
R0543:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0549:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0550:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0699:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0724:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0734:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0847:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0880:Tnfrsf21	UTSW	17	43037842	nonsense	probably null
R1591:Tnfrsf21	UTSW	17	43085374	missense	probably benign	0.01
R2069:Tnfrsf21	UTSW	17	43037938	missense	possibly damaging	0.67
R2153:Tnfrsf21	UTSW	17	43087872	missense	probably damaging	1.00
R2323:Tnfrsf21	UTSW	17	43085529	nonsense	probably null
R3941:Tnfrsf21	UTSW	17	43038010	missense	probably damaging	1.00
R4438:Tnfrsf21	UTSW	17	43087842	missense	possibly damaging	0.49
R4509:Tnfrsf21	UTSW	17	43085388	missense	probably benign	0.00
R4510:Tnfrsf21	UTSW	17	43065019	missense	probably damaging	0.98
R4511:Tnfrsf21	UTSW	17	43065019	missense	probably damaging	0.98
R4708:Tnfrsf21	UTSW	17	43038232	missense	possibly damaging	0.66
R4721:Tnfrsf21	UTSW	17	43085504	missense	probably damaging	1.00
R5437:Tnfrsf21	UTSW	17	43037862	missense	possibly damaging	0.55
R5767:Tnfrsf21	UTSW	17	43037659	missense	probably damaging	0.98
R6057:Tnfrsf21	UTSW	17	43039715	missense	possibly damaging	0.86
R6392:Tnfrsf21	UTSW	17	43017088	missense	probably benign	0.00
R6860:Tnfrsf21	UTSW	17	43017066	missense	probably benign
R7253:Tnfrsf21	UTSW	17	43037667	missense	probably benign	0.00
R7288:Tnfrsf21	UTSW	17	43037818	missense	possibly damaging	0.86
R7643:Tnfrsf21	UTSW	17	43037916	missense	probably benign	0.00
R7937:Tnfrsf21	UTSW	17	43037925	missense	probably benign	0.01
R8098:Tnfrsf21	UTSW	17	43039899	missense	probably benign
R8495:Tnfrsf21	UTSW	17	43038237	missense	probably benign
R8865:Tnfrsf21	UTSW	17	43085481	missense	probably damaging	1.00
R8991:Tnfrsf21	UTSW	17	43085408	missense	probably benign	0.03
R9088:Tnfrsf21	UTSW	17	43037716	missense	probably damaging	1.00
R9150:Tnfrsf21	UTSW	17	43087800	missense	probably damaging	1.00
R9220:Tnfrsf21	UTSW	17	43087910	missense	probably damaging	1.00
V3553:Tnfrsf21	UTSW	17	43037931	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TTGAACAGTGGTGATGACCTG -3'
(R):5'- TACATTCCAGGTGGGCAGATG -3'

Sequencing Primer
(F):5'- AACAGTGGTGATGACCTGTTATTGC -3'
(R):5'- AGATGCACTCTCGGTCAGTCAAG -3'

Posted On

2016-02-04