Incidental Mutation 'R4811:Tnfrsf21'
ID369479
Institutional Source Beutler Lab
Gene Symbol Tnfrsf21
Ensembl Gene ENSMUSG00000023915
Gene Nametumor necrosis factor receptor superfamily, member 21
SynonymsDR6, TR7, Death receptor 6
MMRRC Submission 042430-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R4811 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location43016555-43089188 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 43037730 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 78 (E78K)
Ref Sequence ENSEMBL: ENSMUSP00000024708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024708]
Predicted Effect probably benign
Transcript: ENSMUST00000024708
AA Change: E78K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000024708
Gene: ENSMUSG00000023915
AA Change: E78K

DomainStartEndE-ValueType
TNFR 50 88 1.58e1 SMART
TNFR 91 131 3.42e-3 SMART
TNFR 133 168 9.31e-5 SMART
TNFR 171 211 1.1e-1 SMART
transmembrane domain 351 370 N/A INTRINSIC
DEATH 393 498 1.41e-22 SMART
low complexity region 511 526 N/A INTRINSIC
low complexity region 562 575 N/A INTRINSIC
PDB:2DBH|A 576 655 5e-48 PDB
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tumor necrosis factor receptor superfamily. The encoded protein activates nuclear factor kappa-B and mitogen-activated protein kinase 8 (also called c-Jun N-terminal kinase 1), and induces cell apoptosis. Through its death domain, the encoded receptor interacts with tumor necrosis factor receptor type 1-associated death domain (TRADD) protein, which is known to mediate signal transduction of tumor necrosis factor receptors. Knockout studies in mice suggest that this gene plays a role in T-helper cell activation, and may be involved in inflammation and immune regulation. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired T cell differentiation and an enhanced Th2 response. Mice homozygous for a different knock-out allele show increased CD4+ T cell proliferation and Th2 cytokine production, and enhanced B cell proliferation, survival, and humoral responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447A16Rik G A 15: 37,425,708 probably benign Het
Adam3 C T 8: 24,711,724 G208R probably benign Het
AI481877 T C 4: 59,082,404 N408S probably benign Het
Arsg G T 11: 109,534,072 V290L probably benign Het
Cad A G 5: 31,074,690 T104A probably benign Het
Ccdc180 A G 4: 45,928,020 N1185S probably damaging Het
Cdh18 A G 15: 23,226,791 T113A probably benign Het
Crocc2 G A 1: 93,205,896 A967T probably damaging Het
Cyp4f16 A G 17: 32,545,106 T291A probably benign Het
Dcc T A 18: 71,299,483 H1300L probably benign Het
Ddx23 T A 15: 98,647,471 probably null Het
Dnhd1 T G 7: 105,714,281 S4017A probably damaging Het
Erbb4 A T 1: 68,254,544 F729L probably damaging Het
Ercc6 G T 14: 32,574,929 R1292L probably benign Het
Fam186b C T 15: 99,280,237 V403M probably benign Het
Fam227a T C 15: 79,615,427 N576D possibly damaging Het
Fam46b T C 4: 133,486,370 L184P probably benign Het
Fbln1 A G 15: 85,226,966 probably null Het
Fbxw17 T C 13: 50,425,633 V162A probably benign Het
Gas2l1 A C 11: 5,064,436 I8S probably damaging Het
Gm7030 A G 17: 36,127,776 L241S probably damaging Het
Golgb1 T C 16: 36,891,419 L195P probably damaging Het
Gps2 A T 11: 69,915,928 H233L probably damaging Het
Guf1 T G 5: 69,564,509 probably null Het
Il1rap T A 16: 26,701,238 probably null Het
Ints14 A G 9: 64,964,518 Y46C probably damaging Het
Kalrn T G 16: 34,356,969 Q293H probably damaging Het
Kank2 A G 9: 21,775,747 L593P probably damaging Het
Krt19 T C 11: 100,141,348 T297A possibly damaging Het
Lcp1 T C 14: 75,200,408 V86A probably damaging Het
Lins1 T A 7: 66,708,150 I11K probably benign Het
Lrba T C 3: 86,776,141 F2757L probably damaging Het
Lyst T C 13: 13,777,100 I3762T probably benign Het
Lyzl6 A G 11: 103,635,025 S90P possibly damaging Het
Mfsd2a T A 4: 122,959,382 Q38L probably benign Het
Mtss1 A G 15: 58,944,073 F546S probably damaging Het
Myo5a G A 9: 75,141,543 probably null Het
Naip6 C A 13: 100,285,791 G1245W probably damaging Het
Ndfip1 C T 18: 38,451,592 T107I probably benign Het
Nek8 C T 11: 78,167,718 probably null Het
Nphs1 T C 7: 30,460,429 V55A probably damaging Het
Nrp2 C A 1: 62,719,081 H75Q probably damaging Het
Oas1e C T 5: 120,795,383 S39N probably damaging Het
Olfr1164 A G 2: 88,093,532 F135L probably benign Het
Olfr1391 T G 11: 49,327,748 S112R possibly damaging Het
Olfr309 T C 7: 86,306,958 T52A probably benign Het
Olfr871 A T 9: 20,212,753 I135F probably damaging Het
Pan3 T A 5: 147,530,058 H632Q probably damaging Het
Paqr3 A C 5: 97,095,983 S291A probably benign Het
Pcdh17 A C 14: 84,447,935 D614A probably damaging Het
Pcyox1l T C 18: 61,697,535 E422G possibly damaging Het
Pgr G T 9: 8,900,843 E126* probably null Het
Pik3ap1 A G 19: 41,302,497 V532A possibly damaging Het
Pla2g4c T C 7: 13,337,813 I186T probably damaging Het
Pnkd G A 1: 74,349,405 probably null Het
Poc1a A G 9: 106,349,709 T334A probably damaging Het
Pou2f2 T A 7: 25,097,686 K211* probably null Het
Rdh13 T C 7: 4,442,653 E94G probably benign Het
Rnf186 A G 4: 138,967,187 S13G probably benign Het
Ryr2 T C 13: 11,655,698 R3471G probably damaging Het
Sbf2 T C 7: 110,372,535 T831A probably damaging Het
Sh3gl2 A G 4: 85,398,166 probably benign Het
Snn T C 16: 11,072,533 V72A probably benign Het
Sys1 T A 2: 164,464,424 H99Q possibly damaging Het
Syt7 A G 19: 10,435,567 K122R probably damaging Het
Tas1r2 T A 4: 139,669,000 L550Q probably damaging Het
Thoc1 T C 18: 9,993,438 I599T probably damaging Het
Tle3 C T 9: 61,373,997 probably benign Het
Tll1 A C 8: 64,085,473 V379G possibly damaging Het
Tpgs2 A G 18: 25,129,840 probably benign Het
Trpm1 T C 7: 64,208,306 L165P probably damaging Het
Trpm5 T C 7: 143,080,219 Y750C probably damaging Het
Ttbk2 A C 2: 120,740,070 S1201A possibly damaging Het
Ust T A 10: 8,245,941 H301L probably damaging Het
Vwa5a T C 9: 38,735,953 F543L probably benign Het
Yeats2 T A 16: 20,152,895 probably null Het
Zfp85 T C 13: 67,749,626 Y109C probably damaging Het
Zfr2 T A 10: 81,243,713 V362E probably benign Het
Znrf3 A T 11: 5,287,420 C134S probably benign Het
Other mutations in Tnfrsf21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01406:Tnfrsf21 APN 17 43037946 missense probably damaging 1.00
IGL01663:Tnfrsf21 APN 17 43087811 missense probably benign 0.13
IGL01811:Tnfrsf21 APN 17 43037613 missense probably benign
IGL01916:Tnfrsf21 APN 17 43039803 missense probably benign 0.00
IGL01934:Tnfrsf21 APN 17 43065187 missense probably benign 0.15
IGL02184:Tnfrsf21 APN 17 43085463 missense probably benign 0.37
IGL02292:Tnfrsf21 APN 17 43039911 missense probably benign
IGL02385:Tnfrsf21 APN 17 43040051 missense probably damaging 1.00
IGL02710:Tnfrsf21 APN 17 43087929 missense probably damaging 0.97
IGL03001:Tnfrsf21 APN 17 43087895 missense probably damaging 0.99
IGL03003:Tnfrsf21 APN 17 43039943 missense probably damaging 1.00
palmer_park UTSW 17 43038010 missense probably damaging 1.00
PIT4480001:Tnfrsf21 UTSW 17 43037911 missense probably benign 0.00
R0007:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0046:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0088:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0091:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0102:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0102:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0103:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0105:Tnfrsf21 UTSW 17 43040191 critical splice donor site probably null
R0105:Tnfrsf21 UTSW 17 43040191 critical splice donor site probably null
R0206:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0211:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0240:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0243:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0308:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0363:Tnfrsf21 UTSW 17 43037877 missense probably benign 0.01
R0456:Tnfrsf21 UTSW 17 43038091 missense probably benign 0.01
R0522:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0523:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0525:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0528:Tnfrsf21 UTSW 17 43037614 missense probably benign
R0543:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0549:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0550:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0699:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0724:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0734:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0847:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0880:Tnfrsf21 UTSW 17 43037842 nonsense probably null
R1591:Tnfrsf21 UTSW 17 43085374 missense probably benign 0.01
R2069:Tnfrsf21 UTSW 17 43037938 missense possibly damaging 0.67
R2153:Tnfrsf21 UTSW 17 43087872 missense probably damaging 1.00
R2323:Tnfrsf21 UTSW 17 43085529 nonsense probably null
R3941:Tnfrsf21 UTSW 17 43038010 missense probably damaging 1.00
R4438:Tnfrsf21 UTSW 17 43087842 missense possibly damaging 0.49
R4509:Tnfrsf21 UTSW 17 43085388 missense probably benign 0.00
R4510:Tnfrsf21 UTSW 17 43065019 missense probably damaging 0.98
R4511:Tnfrsf21 UTSW 17 43065019 missense probably damaging 0.98
R4708:Tnfrsf21 UTSW 17 43038232 missense possibly damaging 0.66
R4721:Tnfrsf21 UTSW 17 43085504 missense probably damaging 1.00
R5437:Tnfrsf21 UTSW 17 43037862 missense possibly damaging 0.55
R5767:Tnfrsf21 UTSW 17 43037659 missense probably damaging 0.98
R6057:Tnfrsf21 UTSW 17 43039715 missense possibly damaging 0.86
R6392:Tnfrsf21 UTSW 17 43017088 missense probably benign 0.00
R6860:Tnfrsf21 UTSW 17 43017066 missense probably benign
R7253:Tnfrsf21 UTSW 17 43037667 missense probably benign 0.00
R7288:Tnfrsf21 UTSW 17 43037818 missense possibly damaging 0.86
R7643:Tnfrsf21 UTSW 17 43037916 missense probably benign 0.00
R7937:Tnfrsf21 UTSW 17 43037925 missense probably benign 0.01
R8098:Tnfrsf21 UTSW 17 43039899 missense probably benign
V3553:Tnfrsf21 UTSW 17 43037931 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTGAACAGTGGTGATGACCTG -3'
(R):5'- TACATTCCAGGTGGGCAGATG -3'

Sequencing Primer
(F):5'- AACAGTGGTGATGACCTGTTATTGC -3'
(R):5'- AGATGCACTCTCGGTCAGTCAAG -3'
Posted On2016-02-04