Incidental Mutation 'R4811:Thoc1'
ID369480
Institutional Source Beutler Lab
Gene Symbol Thoc1
Ensembl Gene ENSMUSG00000024287
Gene NameTHO complex 1
Synonyms3110002N20Rik, NMP-84
MMRRC Submission 042430-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4811 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location9958180-9995484 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 9993438 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 599 (I599T)
Ref Sequence ENSEMBL: ENSMUSP00000025137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025137] [ENSMUST00000092096] [ENSMUST00000116669]
Predicted Effect probably damaging
Transcript: ENSMUST00000025137
AA Change: I599T

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000025137
Gene: ENSMUSG00000024287
AA Change: I599T

DomainStartEndE-ValueType
Pfam:efThoc1 69 546 7.2e-149 PFAM
DEATH 560 653 1.27e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000092096
SMART Domains Protein: ENSMUSP00000089728
Gene: ENSMUSG00000047879

DomainStartEndE-ValueType
UBQ 4 74 3.61e-11 SMART
Pfam:UCH 104 479 9e-57 PFAM
Pfam:UCH_1 105 456 3.2e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116669
SMART Domains Protein: ENSMUSP00000112368
Gene: ENSMUSG00000047879

DomainStartEndE-ValueType
UBQ 4 73 2.63e-4 SMART
low complexity region 217 235 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133594
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HPR1 is part of the TREX (transcription/export) complex, which includes TEX1 (MIM 606929), THO2 (MIM 300395), ALY (MIM 604171), and UAP56 (MIM 142560).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mutations in this gene result in embryonic lethality around implantation in homozygotes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447A16Rik G A 15: 37,425,708 probably benign Het
Adam3 C T 8: 24,711,724 G208R probably benign Het
AI481877 T C 4: 59,082,404 N408S probably benign Het
Arsg G T 11: 109,534,072 V290L probably benign Het
Cad A G 5: 31,074,690 T104A probably benign Het
Ccdc180 A G 4: 45,928,020 N1185S probably damaging Het
Cdh18 A G 15: 23,226,791 T113A probably benign Het
Crocc2 G A 1: 93,205,896 A967T probably damaging Het
Cyp4f16 A G 17: 32,545,106 T291A probably benign Het
Dcc T A 18: 71,299,483 H1300L probably benign Het
Ddx23 T A 15: 98,647,471 probably null Het
Dnhd1 T G 7: 105,714,281 S4017A probably damaging Het
Erbb4 A T 1: 68,254,544 F729L probably damaging Het
Ercc6 G T 14: 32,574,929 R1292L probably benign Het
Fam186b C T 15: 99,280,237 V403M probably benign Het
Fam227a T C 15: 79,615,427 N576D possibly damaging Het
Fam46b T C 4: 133,486,370 L184P probably benign Het
Fbln1 A G 15: 85,226,966 probably null Het
Fbxw17 T C 13: 50,425,633 V162A probably benign Het
Gas2l1 A C 11: 5,064,436 I8S probably damaging Het
Gm7030 A G 17: 36,127,776 L241S probably damaging Het
Golgb1 T C 16: 36,891,419 L195P probably damaging Het
Gps2 A T 11: 69,915,928 H233L probably damaging Het
Guf1 T G 5: 69,564,509 probably null Het
Il1rap T A 16: 26,701,238 probably null Het
Ints14 A G 9: 64,964,518 Y46C probably damaging Het
Kalrn T G 16: 34,356,969 Q293H probably damaging Het
Kank2 A G 9: 21,775,747 L593P probably damaging Het
Krt19 T C 11: 100,141,348 T297A possibly damaging Het
Lcp1 T C 14: 75,200,408 V86A probably damaging Het
Lins1 T A 7: 66,708,150 I11K probably benign Het
Lrba T C 3: 86,776,141 F2757L probably damaging Het
Lyst T C 13: 13,777,100 I3762T probably benign Het
Lyzl6 A G 11: 103,635,025 S90P possibly damaging Het
Mfsd2a T A 4: 122,959,382 Q38L probably benign Het
Mtss1 A G 15: 58,944,073 F546S probably damaging Het
Myo5a G A 9: 75,141,543 probably null Het
Naip6 C A 13: 100,285,791 G1245W probably damaging Het
Ndfip1 C T 18: 38,451,592 T107I probably benign Het
Nek8 C T 11: 78,167,718 probably null Het
Nphs1 T C 7: 30,460,429 V55A probably damaging Het
Nrp2 C A 1: 62,719,081 H75Q probably damaging Het
Oas1e C T 5: 120,795,383 S39N probably damaging Het
Olfr1164 A G 2: 88,093,532 F135L probably benign Het
Olfr1391 T G 11: 49,327,748 S112R possibly damaging Het
Olfr309 T C 7: 86,306,958 T52A probably benign Het
Olfr871 A T 9: 20,212,753 I135F probably damaging Het
Pan3 T A 5: 147,530,058 H632Q probably damaging Het
Paqr3 A C 5: 97,095,983 S291A probably benign Het
Pcdh17 A C 14: 84,447,935 D614A probably damaging Het
Pcyox1l T C 18: 61,697,535 E422G possibly damaging Het
Pgr G T 9: 8,900,843 E126* probably null Het
Pik3ap1 A G 19: 41,302,497 V532A possibly damaging Het
Pla2g4c T C 7: 13,337,813 I186T probably damaging Het
Pnkd G A 1: 74,349,405 probably null Het
Poc1a A G 9: 106,349,709 T334A probably damaging Het
Pou2f2 T A 7: 25,097,686 K211* probably null Het
Rdh13 T C 7: 4,442,653 E94G probably benign Het
Rnf186 A G 4: 138,967,187 S13G probably benign Het
Ryr2 T C 13: 11,655,698 R3471G probably damaging Het
Sbf2 T C 7: 110,372,535 T831A probably damaging Het
Sh3gl2 A G 4: 85,398,166 probably benign Het
Snn T C 16: 11,072,533 V72A probably benign Het
Sys1 T A 2: 164,464,424 H99Q possibly damaging Het
Syt7 A G 19: 10,435,567 K122R probably damaging Het
Tas1r2 T A 4: 139,669,000 L550Q probably damaging Het
Tle3 C T 9: 61,373,997 probably benign Het
Tll1 A C 8: 64,085,473 V379G possibly damaging Het
Tnfrsf21 G A 17: 43,037,730 E78K probably benign Het
Tpgs2 A G 18: 25,129,840 probably benign Het
Trpm1 T C 7: 64,208,306 L165P probably damaging Het
Trpm5 T C 7: 143,080,219 Y750C probably damaging Het
Ttbk2 A C 2: 120,740,070 S1201A possibly damaging Het
Ust T A 10: 8,245,941 H301L probably damaging Het
Vwa5a T C 9: 38,735,953 F543L probably benign Het
Yeats2 T A 16: 20,152,895 probably null Het
Zfp85 T C 13: 67,749,626 Y109C probably damaging Het
Zfr2 T A 10: 81,243,713 V362E probably benign Het
Znrf3 A T 11: 5,287,420 C134S probably benign Het
Other mutations in Thoc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00694:Thoc1 APN 18 9989744 missense possibly damaging 0.90
IGL01313:Thoc1 APN 18 9987158 missense probably benign 0.05
IGL01501:Thoc1 APN 18 9986321 missense possibly damaging 0.96
IGL01533:Thoc1 APN 18 9962376 missense probably benign 0.02
IGL01821:Thoc1 APN 18 9993429 missense probably benign
IGL01838:Thoc1 APN 18 9993386 missense possibly damaging 0.94
IGL02193:Thoc1 APN 18 9992863 missense probably benign 0.01
IGL02531:Thoc1 APN 18 9970258 missense probably benign
IGL03203:Thoc1 APN 18 9960483 splice site probably benign
R0724:Thoc1 UTSW 18 9963829 missense probably damaging 1.00
R0831:Thoc1 UTSW 18 9963267 missense probably benign 0.00
R2196:Thoc1 UTSW 18 9986300 missense probably damaging 0.99
R2256:Thoc1 UTSW 18 9993466 missense possibly damaging 0.85
R2257:Thoc1 UTSW 18 9993466 missense possibly damaging 0.85
R2289:Thoc1 UTSW 18 9984488 missense probably damaging 1.00
R2508:Thoc1 UTSW 18 9977947 missense probably damaging 0.99
R2937:Thoc1 UTSW 18 9959255 missense probably damaging 0.96
R3967:Thoc1 UTSW 18 9968787 missense probably damaging 0.99
R4012:Thoc1 UTSW 18 9987651 missense possibly damaging 0.87
R4320:Thoc1 UTSW 18 9960493 missense probably benign
R4686:Thoc1 UTSW 18 9970312 nonsense probably null
R4962:Thoc1 UTSW 18 9962387 missense probably benign 0.01
R5486:Thoc1 UTSW 18 9992204 missense probably benign 0.39
R5648:Thoc1 UTSW 18 9962390 missense possibly damaging 0.94
R6291:Thoc1 UTSW 18 9993330 missense probably benign
R6406:Thoc1 UTSW 18 9977963 missense probably damaging 1.00
R6458:Thoc1 UTSW 18 9993333 missense probably benign
R7379:Thoc1 UTSW 18 9992902 missense probably benign 0.25
R7580:Thoc1 UTSW 18 9986343 missense probably damaging 0.98
R7685:Thoc1 UTSW 18 9993454 nonsense probably null
R7795:Thoc1 UTSW 18 9986300 missense probably damaging 0.96
R7799:Thoc1 UTSW 18 9984441 missense probably damaging 1.00
R8498:Thoc1 UTSW 18 9989693 missense probably benign 0.00
R8779:Thoc1 UTSW 18 9993366 missense probably benign 0.18
X0057:Thoc1 UTSW 18 9992178 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CCCAGTGGTCATTTCAGCTTTG -3'
(R):5'- GAACCTTTTATCAAATGCTGCTTGG -3'

Sequencing Primer
(F):5'- CATTTCAGCTTTGCAGTTATTTCAG -3'
(R):5'- GAAAGCTAACTGTTTGTTTCAGTGTC -3'
Posted On2016-02-04