Incidental Mutation 'R4811:Syt7'
ID 369485
Institutional Source Beutler Lab
Gene Symbol Syt7
Ensembl Gene ENSMUSG00000024743
Gene Name synaptotagmin VII
Synonyms B230112P13Rik
MMRRC Submission 042430-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4811 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 10366454-10430544 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 10412931 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 122 (K122R)
Ref Sequence ENSEMBL: ENSMUSP00000153482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073899] [ENSMUST00000076968] [ENSMUST00000169121] [ENSMUST00000223586] [ENSMUST00000224135]
AlphaFold Q9R0N7
Predicted Effect probably benign
Transcript: ENSMUST00000073899
AA Change: K78R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000073560
Gene: ENSMUSG00000024743
AA Change: K78R

DomainStartEndE-ValueType
transmembrane domain 18 40 N/A INTRINSIC
C2 151 254 3.29e-25 SMART
low complexity region 261 274 N/A INTRINSIC
C2 282 396 4.98e-25 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000076968
AA Change: K286R

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000076234
Gene: ENSMUSG00000024743
AA Change: K286R

DomainStartEndE-ValueType
transmembrane domain 18 40 N/A INTRINSIC
C2 195 298 3.29e-25 SMART
low complexity region 305 318 N/A INTRINSIC
C2 326 440 4.98e-25 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000169121
AA Change: K242R

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000127973
Gene: ENSMUSG00000024743
AA Change: K242R

DomainStartEndE-ValueType
transmembrane domain 17 39 N/A INTRINSIC
low complexity region 104 121 N/A INTRINSIC
C2 315 418 3.29e-25 SMART
low complexity region 425 438 N/A INTRINSIC
C2 446 560 4.98e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000223586
AA Change: K122R

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000224135
AA Change: K193R

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225861
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the synaptotagmin gene family and encodes a protein similar to other family members that mediate calcium-dependent regulation of membrane trafficking in synaptic transmission. A similar protein in rodents mediates hormone secretion and lysosome exocytosis. In humans, expression of this gene has been associated with prostate cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene have no gross abnormalities or obvious neurological defects. They do develop fibrosis in the skin and skeletal muscle over time. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447A16Rik G A 15: 37,425,952 (GRCm39) probably benign Het
Adam3 C T 8: 25,201,740 (GRCm39) G208R probably benign Het
Arsg G T 11: 109,424,898 (GRCm39) V290L probably benign Het
Cad A G 5: 31,232,034 (GRCm39) T104A probably benign Het
Ccdc180 A G 4: 45,928,020 (GRCm39) N1185S probably damaging Het
Cdh18 A G 15: 23,226,877 (GRCm39) T113A probably benign Het
Crocc2 G A 1: 93,133,618 (GRCm39) A967T probably damaging Het
Cyp4f16 A G 17: 32,764,080 (GRCm39) T291A probably benign Het
Dcc T A 18: 71,432,554 (GRCm39) H1300L probably benign Het
Ddx23 T A 15: 98,545,352 (GRCm39) probably null Het
Dnhd1 T G 7: 105,363,488 (GRCm39) S4017A probably damaging Het
Erbb4 A T 1: 68,293,703 (GRCm39) F729L probably damaging Het
Ercc6 G T 14: 32,296,886 (GRCm39) R1292L probably benign Het
Fam186b C T 15: 99,178,118 (GRCm39) V403M probably benign Het
Fam227a T C 15: 79,499,628 (GRCm39) N576D possibly damaging Het
Fbln1 A G 15: 85,111,167 (GRCm39) probably null Het
Fbxw17 T C 13: 50,579,669 (GRCm39) V162A probably benign Het
Gas2l1 A C 11: 5,014,436 (GRCm39) I8S probably damaging Het
Golgb1 T C 16: 36,711,781 (GRCm39) L195P probably damaging Het
Gps2 A T 11: 69,806,754 (GRCm39) H233L probably damaging Het
Guf1 T G 5: 69,721,852 (GRCm39) probably null Het
H2-T9 A G 17: 36,438,668 (GRCm39) L241S probably damaging Het
Il1rap T A 16: 26,519,988 (GRCm39) probably null Het
Ints14 A G 9: 64,871,800 (GRCm39) Y46C probably damaging Het
Kalrn T G 16: 34,177,339 (GRCm39) Q293H probably damaging Het
Kank2 A G 9: 21,687,043 (GRCm39) L593P probably damaging Het
Krt19 T C 11: 100,032,174 (GRCm39) T297A possibly damaging Het
Lcp1 T C 14: 75,437,848 (GRCm39) V86A probably damaging Het
Lins1 T A 7: 66,357,898 (GRCm39) I11K probably benign Het
Lrba T C 3: 86,683,448 (GRCm39) F2757L probably damaging Het
Lyst T C 13: 13,951,685 (GRCm39) I3762T probably benign Het
Lyzl6 A G 11: 103,525,851 (GRCm39) S90P possibly damaging Het
Mfsd2a T A 4: 122,853,175 (GRCm39) Q38L probably benign Het
Mtss1 A G 15: 58,815,922 (GRCm39) F546S probably damaging Het
Myo5a G A 9: 75,048,825 (GRCm39) probably null Het
Naip6 C A 13: 100,422,299 (GRCm39) G1245W probably damaging Het
Ndfip1 C T 18: 38,584,645 (GRCm39) T107I probably benign Het
Nek8 C T 11: 78,058,544 (GRCm39) probably null Het
Nphs1 T C 7: 30,159,854 (GRCm39) V55A probably damaging Het
Nrp2 C A 1: 62,758,240 (GRCm39) H75Q probably damaging Het
Oas1e C T 5: 120,933,448 (GRCm39) S39N probably damaging Het
Or13g1 T C 7: 85,956,166 (GRCm39) T52A probably benign Het
Or2y1e T G 11: 49,218,575 (GRCm39) S112R possibly damaging Het
Or5d37 A G 2: 87,923,876 (GRCm39) F135L probably benign Het
Or7h8 A T 9: 20,124,049 (GRCm39) I135F probably damaging Het
Pan3 T A 5: 147,466,868 (GRCm39) H632Q probably damaging Het
Paqr3 A C 5: 97,243,842 (GRCm39) S291A probably benign Het
Pcdh17 A C 14: 84,685,375 (GRCm39) D614A probably damaging Het
Pcyox1l T C 18: 61,830,606 (GRCm39) E422G possibly damaging Het
Pgr G T 9: 8,900,844 (GRCm39) E126* probably null Het
Pik3ap1 A G 19: 41,290,936 (GRCm39) V532A possibly damaging Het
Pla2g4c T C 7: 13,071,738 (GRCm39) I186T probably damaging Het
Pnkd G A 1: 74,388,564 (GRCm39) probably null Het
Poc1a A G 9: 106,226,908 (GRCm39) T334A probably damaging Het
Pou2f2 T A 7: 24,797,111 (GRCm39) K211* probably null Het
Rdh13 T C 7: 4,445,652 (GRCm39) E94G probably benign Het
Rnf186 A G 4: 138,694,498 (GRCm39) S13G probably benign Het
Ryr2 T C 13: 11,670,584 (GRCm39) R3471G probably damaging Het
Sbf2 T C 7: 109,971,742 (GRCm39) T831A probably damaging Het
Sh3gl2 A G 4: 85,316,403 (GRCm39) probably benign Het
Shoc1 T C 4: 59,082,404 (GRCm39) N408S probably benign Het
Snn T C 16: 10,890,397 (GRCm39) V72A probably benign Het
Sys1 T A 2: 164,306,344 (GRCm39) H99Q possibly damaging Het
Tas1r2 T A 4: 139,396,311 (GRCm39) L550Q probably damaging Het
Tent5b T C 4: 133,213,681 (GRCm39) L184P probably benign Het
Thoc1 T C 18: 9,993,438 (GRCm39) I599T probably damaging Het
Tle3 C T 9: 61,281,279 (GRCm39) probably benign Het
Tll1 A C 8: 64,538,507 (GRCm39) V379G possibly damaging Het
Tnfrsf21 G A 17: 43,348,621 (GRCm39) E78K probably benign Het
Tpgs2 A G 18: 25,262,897 (GRCm39) probably benign Het
Trpm1 T C 7: 63,858,054 (GRCm39) L165P probably damaging Het
Trpm5 T C 7: 142,633,956 (GRCm39) Y750C probably damaging Het
Ttbk2 A C 2: 120,570,551 (GRCm39) S1201A possibly damaging Het
Ust T A 10: 8,121,705 (GRCm39) H301L probably damaging Het
Vwa5a T C 9: 38,647,249 (GRCm39) F543L probably benign Het
Yeats2 T A 16: 19,971,645 (GRCm39) probably null Het
Zfp85 T C 13: 67,897,745 (GRCm39) Y109C probably damaging Het
Zfr2 T A 10: 81,079,547 (GRCm39) V362E probably benign Het
Znrf3 A T 11: 5,237,420 (GRCm39) C134S probably benign Het
Other mutations in Syt7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01956:Syt7 APN 19 10,420,755 (GRCm39) missense probably benign 0.03
R0412:Syt7 UTSW 19 10,421,444 (GRCm39) nonsense probably null
R1068:Syt7 UTSW 19 10,421,375 (GRCm39) missense probably benign 0.01
R1793:Syt7 UTSW 19 10,421,354 (GRCm39) missense probably damaging 1.00
R1955:Syt7 UTSW 19 10,395,402 (GRCm39) missense probably damaging 1.00
R2049:Syt7 UTSW 19 10,416,577 (GRCm39) missense probably benign 0.28
R2170:Syt7 UTSW 19 10,416,744 (GRCm39) missense probably damaging 1.00
R2911:Syt7 UTSW 19 10,420,799 (GRCm39) missense probably benign 0.00
R3694:Syt7 UTSW 19 10,413,000 (GRCm39) missense possibly damaging 0.69
R4330:Syt7 UTSW 19 10,399,162 (GRCm39) missense probably damaging 1.00
R4573:Syt7 UTSW 19 10,416,576 (GRCm39) nonsense probably null
R4691:Syt7 UTSW 19 10,403,845 (GRCm39) missense probably damaging 0.98
R4732:Syt7 UTSW 19 10,420,288 (GRCm39) missense probably damaging 1.00
R4733:Syt7 UTSW 19 10,420,288 (GRCm39) missense probably damaging 1.00
R5067:Syt7 UTSW 19 10,420,222 (GRCm39) missense possibly damaging 0.58
R5069:Syt7 UTSW 19 10,416,601 (GRCm39) missense probably benign 0.00
R5071:Syt7 UTSW 19 10,420,792 (GRCm39) missense possibly damaging 0.92
R5372:Syt7 UTSW 19 10,403,985 (GRCm39) missense probably damaging 1.00
R5830:Syt7 UTSW 19 10,399,151 (GRCm39) missense probably damaging 1.00
R5979:Syt7 UTSW 19 10,420,843 (GRCm39) missense probably damaging 1.00
R6737:Syt7 UTSW 19 10,421,408 (GRCm39) missense probably damaging 1.00
R6833:Syt7 UTSW 19 10,421,508 (GRCm39) missense probably damaging 1.00
R6843:Syt7 UTSW 19 10,399,135 (GRCm39) missense probably damaging 1.00
R7010:Syt7 UTSW 19 10,395,354 (GRCm39) missense probably benign 0.16
R7078:Syt7 UTSW 19 10,412,963 (GRCm39) missense probably benign 0.14
R7206:Syt7 UTSW 19 10,395,337 (GRCm39) missense probably damaging 1.00
R9116:Syt7 UTSW 19 10,421,373 (GRCm39) missense probably damaging 1.00
R9451:Syt7 UTSW 19 10,421,532 (GRCm39) missense probably damaging 1.00
R9582:Syt7 UTSW 19 10,416,780 (GRCm39) missense probably damaging 1.00
R9610:Syt7 UTSW 19 10,421,459 (GRCm39) missense probably benign 0.06
Z1176:Syt7 UTSW 19 10,420,774 (GRCm39) missense probably damaging 1.00
Z1177:Syt7 UTSW 19 10,403,857 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACCTGAGACAGAGGCTCAAG -3'
(R):5'- CTGAGTTGACTACTTCTGGTCC -3'

Sequencing Primer
(F):5'- GAAACACCAGGCTTTCTGTG -3'
(R):5'- GACTACTTCTGGTCCCCCAACAG -3'
Posted On 2016-02-04