Incidental Mutation 'R4812:Plcb4'
ID369502
Institutional Source Beutler Lab
Gene Symbol Plcb4
Ensembl Gene ENSMUSG00000039943
Gene Namephospholipase C, beta 4
SynonymsA930039J07Rik, C230058B11Rik
MMRRC Submission 042431-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4812 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location135659011-136014593 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 136007881 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 205 (L205Q)
Ref Sequence ENSEMBL: ENSMUSP00000117578 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035646] [ENSMUST00000110109] [ENSMUST00000147744] [ENSMUST00000184371]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035646
AA Change: L1144Q

PolyPhen 2 Score 0.691 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000038409
Gene: ENSMUSG00000039943
AA Change: L1144Q

DomainStartEndE-ValueType
Pfam:EF-hand_like 221 312 1.1e-26 PFAM
PLCXc 313 463 2.68e-79 SMART
low complexity region 498 509 N/A INTRINSIC
PLCYc 565 681 2.9e-75 SMART
C2 702 801 1.6e-14 SMART
Pfam:DUF1154 909 955 4.3e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110109
AA Change: L1144Q

PolyPhen 2 Score 0.691 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000105736
Gene: ENSMUSG00000039943
AA Change: L1144Q

DomainStartEndE-ValueType
Pfam:EF-hand_like 221 312 6.1e-27 PFAM
PLCXc 313 463 2.68e-79 SMART
low complexity region 498 509 N/A INTRINSIC
PLCYc 565 681 2.9e-75 SMART
C2 702 801 1.6e-14 SMART
Pfam:DUF1154 913 955 1.2e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147122
Predicted Effect probably damaging
Transcript: ENSMUST00000147744
AA Change: L205Q

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000117578
Gene: ENSMUSG00000039943
AA Change: L205Q

DomainStartEndE-ValueType
Pfam:DUF1154 1 16 1.7e-7 PFAM
coiled coil region 187 217 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184371
SMART Domains Protein: ENSMUSP00000139274
Gene: ENSMUSG00000039943

DomainStartEndE-ValueType
Pfam:EF-hand_like 221 312 9e-27 PFAM
PLCXc 313 463 2.68e-79 SMART
low complexity region 498 509 N/A INTRINSIC
PLCYc 565 681 2.9e-75 SMART
C2 702 801 1.6e-14 SMART
Pfam:DUF1154 909 955 4.1e-23 PFAM
Meta Mutation Damage Score 0.1225 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 93% (124/133)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the formation of inositol 1,4,5-trisphosphate and diacylglycerol from phosphatidylinositol 4,5-bisphosphate. This reaction uses calcium as a cofactor and plays an important role in the intracellular transduction of many extracellular signals in the retina. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygotes for targeted mutations may exhibit ataxia, impaired elimination of excess climbing fiber synapses in the developing cerebellum, abnormal cerebellar foliation, reduced visual processing ability and loss of circadian rhythm in constant darkness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 128 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017G19Rik C T 3: 40,521,484 noncoding transcript Het
2410089E03Rik T G 15: 8,201,123 probably null Het
Abca5 T C 11: 110,301,821 D681G probably damaging Het
Actl11 T C 9: 107,931,130 V884A probably damaging Het
Akr1c14 G A 13: 4,079,165 V187M probably damaging Het
Apbb1 A T 7: 105,574,025 N126K probably damaging Het
Armc4 T G 18: 7,288,634 T78P possibly damaging Het
Bmt2 G T 6: 13,677,800 R12S unknown Het
Btrc G A 19: 45,423,164 C9Y possibly damaging Het
C5ar1 A C 7: 16,248,333 probably null Het
C8a C T 4: 104,862,591 probably null Het
Cabin1 A G 10: 75,646,594 S2172P possibly damaging Het
Calcoco2 T C 11: 96,107,450 D49G probably damaging Het
Camta1 C T 4: 151,131,542 D974N probably null Het
Car6 T C 4: 150,197,415 E47G probably damaging Het
Ccdc105 T C 10: 78,749,216 H262R probably benign Het
Ccnd3 G A 17: 47,597,580 probably null Het
Celf5 A T 10: 81,470,739 V30E probably damaging Het
Cfap46 T A 7: 139,636,000 D1513V probably damaging Het
Cinp T C 12: 110,879,740 Y84C probably damaging Het
Cnih1 A G 14: 46,776,544 I154T probably damaging Het
Col15a1 C T 4: 47,262,479 P511L possibly damaging Het
Col4a4 C T 1: 82,462,153 V1364M unknown Het
Crtam A G 9: 40,984,325 L38P probably damaging Het
Ctnna1 T A 18: 35,239,477 V495D probably damaging Het
Cubn T C 2: 13,459,076 Y606C probably damaging Het
Cyp4f16 C T 17: 32,546,678 A345V probably null Het
Dctn1 A T 6: 83,189,937 M160L probably benign Het
Dip2c T A 13: 9,637,130 C366* probably null Het
Dnajc2 G A 5: 21,763,486 S401L probably benign Het
Dnmt3l A G 10: 78,057,294 I302V probably benign Het
Dvl2 T C 11: 70,011,293 probably benign Het
Edn1 T G 13: 42,303,640 S50A probably benign Het
Efhc1 A T 1: 20,990,647 R636W probably damaging Het
Epg5 T A 18: 77,979,184 H1047Q probably benign Het
Etv1 T G 12: 38,861,288 V371G probably damaging Het
Fam71e2 G A 7: 4,759,072 T295M probably damaging Het
Fap T A 2: 62,519,021 I475F probably damaging Het
Fbxw15 T C 9: 109,559,922 I140V probably benign Het
Fer A G 17: 63,934,297 T311A probably benign Het
Fh1 A G 1: 175,601,459 W497R probably damaging Het
Flot2 T A 11: 78,053,365 L45Q probably damaging Het
Flt1 C A 5: 147,683,939 A132S probably benign Het
Fmnl1 T C 11: 103,198,564 probably benign Het
Ggta1 C T 2: 35,402,723 V203I probably benign Het
Gm19345 C T 7: 19,857,873 V204M probably damaging Het
Gm4204 T A 1: 135,232,489 noncoding transcript Het
Gm6124 C G 7: 39,222,895 noncoding transcript Het
Gprin3 T A 6: 59,353,365 K652N possibly damaging Het
Gucy1b2 T C 14: 62,415,897 probably null Het
Hace1 C A 10: 45,686,603 A738E probably benign Het
Hectd1 C T 12: 51,827,351 probably null Het
Hnrnpdl T C 5: 100,036,472 probably benign Het
Hyou1 T C 9: 44,387,121 probably benign Het
Ifi44l G A 3: 151,759,699 A138V probably benign Het
Igkv16-104 A T 6: 68,425,845 I41F possibly damaging Het
Ints7 T A 1: 191,594,430 D171E possibly damaging Het
Kmt2a A T 9: 44,831,354 probably benign Het
Kmt2e T C 5: 23,502,587 V1716A possibly damaging Het
Krtap5-1 G A 7: 142,296,891 S60F unknown Het
Lama4 G A 10: 39,072,769 V843I probably benign Het
Laptm5 A G 4: 130,913,438 probably null Het
Lbhd1 G A 19: 8,889,174 A193T probably damaging Het
Lce3f C T 3: 92,992,940 P23S unknown Het
Lrmp G A 6: 145,148,011 G120S probably damaging Het
Mecom A C 3: 30,140,368 M1R probably null Het
Mindy4 A C 6: 55,279,103 T531P possibly damaging Het
Mrpl3 A G 9: 105,073,824 N263S probably damaging Het
Myo18b T C 5: 112,809,718 K1460E possibly damaging Het
Myof A G 19: 37,916,559 Y852H probably damaging Het
Nefl T G 14: 68,084,285 V108G probably damaging Het
Nid1 T A 13: 13,506,468 L1061* probably null Het
Nim1k T A 13: 119,712,384 M325L probably benign Het
Nlrp1c-ps T C 11: 71,252,305 noncoding transcript Het
Npsr1 C T 9: 24,289,956 T59I probably damaging Het
Nr2c1 A G 10: 94,188,252 T440A probably benign Het
Nup160 C T 2: 90,725,691 T1245I probably damaging Het
Nup88 T A 11: 70,965,726 T194S probably damaging Het
Oas3 A G 5: 120,761,147 probably benign Het
Olfr1129 A G 2: 87,575,743 I220V probably benign Het
Olfr1274-ps T A 2: 90,401,096 M145K probably benign Het
Olfr1393 T A 11: 49,280,457 I103K possibly damaging Het
Opn1sw A T 6: 29,378,039 M252K probably damaging Het
Oprm1 T G 10: 6,832,698 probably benign Het
Pcdha2 T A 18: 36,939,808 V164E probably benign Het
Pclo A G 5: 14,540,025 T780A unknown Het
Pcnx2 T A 8: 125,865,939 Q762L probably benign Het
Pcyt2 A T 11: 120,614,425 probably benign Het
Pdpr A G 8: 111,116,717 N294D probably benign Het
Perm1 T A 4: 156,218,736 V579E possibly damaging Het
Pgk2 T A 17: 40,207,390 K382N possibly damaging Het
Plekha3 C T 2: 76,686,631 T109I probably damaging Het
Pnn T A 12: 59,071,618 V329E possibly damaging Het
Ptpn13 A G 5: 103,523,615 I469M probably benign Het
Rapgef3 A G 15: 97,753,803 V603A probably benign Het
Rbms1 C T 2: 60,792,769 V75I possibly damaging Het
Rbp3 T A 14: 33,954,774 D226E probably damaging Het
Robo2 A T 16: 73,916,288 N1189K probably benign Het
Rragd A G 4: 33,018,766 T270A probably benign Het
Rxfp1 T A 3: 79,650,582 T530S probably benign Het
Ryr3 T C 2: 112,912,236 E479G probably damaging Het
Scd2 A T 19: 44,301,402 I279F probably damaging Het
Sh3d19 A T 3: 86,123,767 D746V probably damaging Het
Shroom4 A G X: 6,624,126 K1133E probably benign Het
Sirpb1c A G 3: 15,833,222 V151A probably damaging Het
Slc26a2 A T 18: 61,202,021 I120N probably damaging Het
Slco1a1 A G 6: 141,918,593 S494P probably damaging Het
Srebf2 A T 15: 82,203,825 T1061S probably damaging Het
Sspo T C 6: 48,490,510 L4202P probably benign Het
Synj2 G A 17: 6,010,664 G215E probably damaging Het
Tbc1d19 T C 5: 53,809,806 V16A probably damaging Het
Tiparp T C 3: 65,552,769 I495T possibly damaging Het
Tipin A G 9: 64,304,412 H260R probably benign Het
Tle1 A G 4: 72,145,354 S221P probably damaging Het
Tmem94 T A 11: 115,796,112 L1101* probably null Het
Trim43b C T 9: 89,091,480 D67N probably benign Het
Ubn2 T A 6: 38,463,726 C178S probably benign Het
Vmn1r54 T C 6: 90,269,325 F74L probably benign Het
Vmn2r24 A G 6: 123,779,185 H72R probably benign Het
Wdr66 G A 5: 123,287,305 V776I probably benign Het
Wnk1 C T 6: 119,952,771 V850I probably benign Het
Zan T G 5: 137,456,285 Y1419S unknown Het
Zbtb14 T A 17: 69,387,582 Y92N probably damaging Het
Zfand5 A G 19: 21,277,737 K116E probably benign Het
Zfhx3 A G 8: 108,947,961 E1881G possibly damaging Het
Zfp280b A G 10: 76,039,090 K268E probably benign Het
Zfp541 A G 7: 16,079,110 I563V probably benign Het
Zfy2 T A Y: 2,106,334 I767L probably benign Het
Other mutations in Plcb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Plcb4 APN 2 135971798 missense probably benign 0.26
IGL01405:Plcb4 APN 2 135950347 missense probably damaging 1.00
IGL01522:Plcb4 APN 2 136002627 missense probably damaging 1.00
IGL01589:Plcb4 APN 2 135967118 missense probably benign
IGL02090:Plcb4 APN 2 135947121 missense probably benign 0.00
IGL02247:Plcb4 APN 2 135994325 missense possibly damaging 0.95
IGL02259:Plcb4 APN 2 135910246 critical splice donor site probably null
IGL02338:Plcb4 APN 2 136000180 missense possibly damaging 0.87
IGL02625:Plcb4 APN 2 135961794 missense probably benign 0.19
IGL03026:Plcb4 APN 2 135950429 splice site probably benign
IGL03111:Plcb4 APN 2 135976282 missense probably damaging 1.00
R0044:Plcb4 UTSW 2 135971856 missense probably damaging 1.00
R0066:Plcb4 UTSW 2 135961769 missense probably benign 0.10
R0066:Plcb4 UTSW 2 135961769 missense probably benign 0.10
R0143:Plcb4 UTSW 2 135976211 missense probably damaging 1.00
R0234:Plcb4 UTSW 2 135982075 missense probably benign 0.00
R0234:Plcb4 UTSW 2 135982075 missense probably benign 0.00
R0348:Plcb4 UTSW 2 135968419 missense probably damaging 1.00
R0557:Plcb4 UTSW 2 135954349 missense probably damaging 0.99
R0591:Plcb4 UTSW 2 135955012 splice site probably benign
R0975:Plcb4 UTSW 2 135987912 splice site probably benign
R1187:Plcb4 UTSW 2 135968394 missense probably benign 0.36
R1235:Plcb4 UTSW 2 135972948 missense probably damaging 1.00
R1445:Plcb4 UTSW 2 136000189 missense possibly damaging 0.90
R1562:Plcb4 UTSW 2 135970447 critical splice donor site probably null
R1594:Plcb4 UTSW 2 135970390 splice site probably benign
R1920:Plcb4 UTSW 2 136013027 missense probably damaging 1.00
R2041:Plcb4 UTSW 2 135938271 missense probably damaging 1.00
R2141:Plcb4 UTSW 2 135976099 missense probably damaging 1.00
R2142:Plcb4 UTSW 2 135976099 missense probably damaging 1.00
R2202:Plcb4 UTSW 2 136002594 missense probably benign 0.01
R2203:Plcb4 UTSW 2 136002594 missense probably benign 0.01
R2204:Plcb4 UTSW 2 136002594 missense probably benign 0.01
R2250:Plcb4 UTSW 2 135971861 critical splice donor site probably null
R2291:Plcb4 UTSW 2 135939983 missense probably benign 0.08
R2326:Plcb4 UTSW 2 135939973 missense probably damaging 0.99
R2442:Plcb4 UTSW 2 135950382 missense probably damaging 1.00
R2939:Plcb4 UTSW 2 135939203 splice site probably benign
R3774:Plcb4 UTSW 2 135958145 missense probably benign 0.00
R3875:Plcb4 UTSW 2 136002632 missense probably damaging 0.99
R4594:Plcb4 UTSW 2 136002599 missense probably damaging 0.98
R4673:Plcb4 UTSW 2 135932271 missense possibly damaging 0.68
R5084:Plcb4 UTSW 2 136002651 missense probably damaging 1.00
R5468:Plcb4 UTSW 2 135967152 missense probably damaging 1.00
R5498:Plcb4 UTSW 2 135976172 missense probably damaging 1.00
R5923:Plcb4 UTSW 2 135961814 nonsense probably null
R6241:Plcb4 UTSW 2 135910174 missense possibly damaging 0.80
R6492:Plcb4 UTSW 2 135973071 nonsense probably null
R6514:Plcb4 UTSW 2 135954996 missense probably benign 0.22
R6570:Plcb4 UTSW 2 135982986 missense probably benign 0.13
R6721:Plcb4 UTSW 2 135910237 missense probably benign 0.01
R6915:Plcb4 UTSW 2 135947115 missense possibly damaging 0.84
R6991:Plcb4 UTSW 2 135910194 missense probably damaging 1.00
R7040:Plcb4 UTSW 2 135932262 missense probably benign
R7086:Plcb4 UTSW 2 136007847 missense probably benign
R7114:Plcb4 UTSW 2 135982123 critical splice donor site probably null
R7249:Plcb4 UTSW 2 136007821 critical splice acceptor site probably null
R7264:Plcb4 UTSW 2 135965080 missense probably benign
R7361:Plcb4 UTSW 2 135976148 missense possibly damaging 0.82
R7426:Plcb4 UTSW 2 136000219 missense probably benign 0.00
R7429:Plcb4 UTSW 2 135968322 missense probably damaging 1.00
R7430:Plcb4 UTSW 2 135968322 missense probably damaging 1.00
R8010:Plcb4 UTSW 2 135907560 missense probably benign 0.00
Z1177:Plcb4 UTSW 2 135958738 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGGGAAGGAAAGATCTGCCC -3'
(R):5'- GGGCCATCACACTTAGAACC -3'

Sequencing Primer
(F):5'- AACCCTTAACAGTTTTCAAGCTC -3'
(R):5'- TTAGAACCCATCCTGTCATAGACTC -3'
Posted On2016-02-04