Incidental Mutation 'R4812:Oas3'
ID369527
Institutional Source Beutler Lab
Gene Symbol Oas3
Ensembl Gene ENSMUSG00000032661
Gene Name2'-5' oligoadenylate synthetase 3
SynonymsOasl10, 2'-5' oligoadenylate synthetase-like 10
MMRRC Submission 042431-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R4812 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location120753098-120777661 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 120761147 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044833] [ENSMUST00000165820]
Predicted Effect unknown
Transcript: ENSMUST00000044833
AA Change: L787P
SMART Domains Protein: ENSMUSP00000035588
Gene: ENSMUSG00000032661
AA Change: L787P

DomainStartEndE-ValueType
Pfam:OAS1_C 159 341 6.3e-83 PFAM
Pfam:OAS1_C 610 795 3.1e-78 PFAM
Pfam:NTP_transf_2 831 920 4.5e-11 PFAM
Pfam:OAS1_C 954 1136 9e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165820
SMART Domains Protein: ENSMUSP00000125873
Gene: ENSMUSG00000032661

DomainStartEndE-ValueType
Pfam:OAS1_C 1 130 3.8e-53 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166703
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200795
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 93% (124/133)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme included in the 2', 5' oligoadenylate synthase family. This enzyme is induced by interferons and catalyzes the 2', 5' oligomers of adenosine in order to bind and activate RNase L. This enzyme family plays a significant role in the inhibition of cellular protein synthesis and viral infection resistance. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 128 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017G19Rik C T 3: 40,521,484 noncoding transcript Het
2410089E03Rik T G 15: 8,201,123 probably null Het
Abca5 T C 11: 110,301,821 D681G probably damaging Het
Actl11 T C 9: 107,931,130 V884A probably damaging Het
Akr1c14 G A 13: 4,079,165 V187M probably damaging Het
Apbb1 A T 7: 105,574,025 N126K probably damaging Het
Armc4 T G 18: 7,288,634 T78P possibly damaging Het
Bmt2 G T 6: 13,677,800 R12S unknown Het
Btrc G A 19: 45,423,164 C9Y possibly damaging Het
C5ar1 A C 7: 16,248,333 probably null Het
C8a C T 4: 104,862,591 probably null Het
Cabin1 A G 10: 75,646,594 S2172P possibly damaging Het
Calcoco2 T C 11: 96,107,450 D49G probably damaging Het
Camta1 C T 4: 151,131,542 D974N probably null Het
Car6 T C 4: 150,197,415 E47G probably damaging Het
Ccdc105 T C 10: 78,749,216 H262R probably benign Het
Ccnd3 G A 17: 47,597,580 probably null Het
Celf5 A T 10: 81,470,739 V30E probably damaging Het
Cfap46 T A 7: 139,636,000 D1513V probably damaging Het
Cinp T C 12: 110,879,740 Y84C probably damaging Het
Cnih1 A G 14: 46,776,544 I154T probably damaging Het
Col15a1 C T 4: 47,262,479 P511L possibly damaging Het
Col4a4 C T 1: 82,462,153 V1364M unknown Het
Crtam A G 9: 40,984,325 L38P probably damaging Het
Ctnna1 T A 18: 35,239,477 V495D probably damaging Het
Cubn T C 2: 13,459,076 Y606C probably damaging Het
Cyp4f16 C T 17: 32,546,678 A345V probably null Het
Dctn1 A T 6: 83,189,937 M160L probably benign Het
Dip2c T A 13: 9,637,130 C366* probably null Het
Dnajc2 G A 5: 21,763,486 S401L probably benign Het
Dnmt3l A G 10: 78,057,294 I302V probably benign Het
Dvl2 T C 11: 70,011,293 probably benign Het
Edn1 T G 13: 42,303,640 S50A probably benign Het
Efhc1 A T 1: 20,990,647 R636W probably damaging Het
Epg5 T A 18: 77,979,184 H1047Q probably benign Het
Etv1 T G 12: 38,861,288 V371G probably damaging Het
Fam71e2 G A 7: 4,759,072 T295M probably damaging Het
Fap T A 2: 62,519,021 I475F probably damaging Het
Fbxw15 T C 9: 109,559,922 I140V probably benign Het
Fer A G 17: 63,934,297 T311A probably benign Het
Fh1 A G 1: 175,601,459 W497R probably damaging Het
Flot2 T A 11: 78,053,365 L45Q probably damaging Het
Flt1 C A 5: 147,683,939 A132S probably benign Het
Fmnl1 T C 11: 103,198,564 probably benign Het
Ggta1 C T 2: 35,402,723 V203I probably benign Het
Gm19345 C T 7: 19,857,873 V204M probably damaging Het
Gm4204 T A 1: 135,232,489 noncoding transcript Het
Gm6124 C G 7: 39,222,895 noncoding transcript Het
Gprin3 T A 6: 59,353,365 K652N possibly damaging Het
Gucy1b2 T C 14: 62,415,897 probably null Het
Hace1 C A 10: 45,686,603 A738E probably benign Het
Hectd1 C T 12: 51,827,351 probably null Het
Hnrnpdl T C 5: 100,036,472 probably benign Het
Hyou1 T C 9: 44,387,121 probably benign Het
Ifi44l G A 3: 151,759,699 A138V probably benign Het
Igkv16-104 A T 6: 68,425,845 I41F possibly damaging Het
Ints7 T A 1: 191,594,430 D171E possibly damaging Het
Kmt2a A T 9: 44,831,354 probably benign Het
Kmt2e T C 5: 23,502,587 V1716A possibly damaging Het
Krtap5-1 G A 7: 142,296,891 S60F unknown Het
Lama4 G A 10: 39,072,769 V843I probably benign Het
Laptm5 A G 4: 130,913,438 probably null Het
Lbhd1 G A 19: 8,889,174 A193T probably damaging Het
Lce3f C T 3: 92,992,940 P23S unknown Het
Lrmp G A 6: 145,148,011 G120S probably damaging Het
Mecom A C 3: 30,140,368 M1R probably null Het
Mindy4 A C 6: 55,279,103 T531P possibly damaging Het
Mrpl3 A G 9: 105,073,824 N263S probably damaging Het
Myo18b T C 5: 112,809,718 K1460E possibly damaging Het
Myof A G 19: 37,916,559 Y852H probably damaging Het
Nefl T G 14: 68,084,285 V108G probably damaging Het
Nid1 T A 13: 13,506,468 L1061* probably null Het
Nim1k T A 13: 119,712,384 M325L probably benign Het
Nlrp1c-ps T C 11: 71,252,305 noncoding transcript Het
Npsr1 C T 9: 24,289,956 T59I probably damaging Het
Nr2c1 A G 10: 94,188,252 T440A probably benign Het
Nup160 C T 2: 90,725,691 T1245I probably damaging Het
Nup88 T A 11: 70,965,726 T194S probably damaging Het
Olfr1129 A G 2: 87,575,743 I220V probably benign Het
Olfr1274-ps T A 2: 90,401,096 M145K probably benign Het
Olfr1393 T A 11: 49,280,457 I103K possibly damaging Het
Opn1sw A T 6: 29,378,039 M252K probably damaging Het
Oprm1 T G 10: 6,832,698 probably benign Het
Pcdha2 T A 18: 36,939,808 V164E probably benign Het
Pclo A G 5: 14,540,025 T780A unknown Het
Pcnx2 T A 8: 125,865,939 Q762L probably benign Het
Pcyt2 A T 11: 120,614,425 probably benign Het
Pdpr A G 8: 111,116,717 N294D probably benign Het
Perm1 T A 4: 156,218,736 V579E possibly damaging Het
Pgk2 T A 17: 40,207,390 K382N possibly damaging Het
Plcb4 T A 2: 136,007,881 L205Q probably damaging Het
Plekha3 C T 2: 76,686,631 T109I probably damaging Het
Pnn T A 12: 59,071,618 V329E possibly damaging Het
Ptpn13 A G 5: 103,523,615 I469M probably benign Het
Rapgef3 A G 15: 97,753,803 V603A probably benign Het
Rbms1 C T 2: 60,792,769 V75I possibly damaging Het
Rbp3 T A 14: 33,954,774 D226E probably damaging Het
Robo2 A T 16: 73,916,288 N1189K probably benign Het
Rragd A G 4: 33,018,766 T270A probably benign Het
Rxfp1 T A 3: 79,650,582 T530S probably benign Het
Ryr3 T C 2: 112,912,236 E479G probably damaging Het
Scd2 A T 19: 44,301,402 I279F probably damaging Het
Sh3d19 A T 3: 86,123,767 D746V probably damaging Het
Shroom4 A G X: 6,624,126 K1133E probably benign Het
Sirpb1c A G 3: 15,833,222 V151A probably damaging Het
Slc26a2 A T 18: 61,202,021 I120N probably damaging Het
Slco1a1 A G 6: 141,918,593 S494P probably damaging Het
Srebf2 A T 15: 82,203,825 T1061S probably damaging Het
Sspo T C 6: 48,490,510 L4202P probably benign Het
Synj2 G A 17: 6,010,664 G215E probably damaging Het
Tbc1d19 T C 5: 53,809,806 V16A probably damaging Het
Tiparp T C 3: 65,552,769 I495T possibly damaging Het
Tipin A G 9: 64,304,412 H260R probably benign Het
Tle1 A G 4: 72,145,354 S221P probably damaging Het
Tmem94 T A 11: 115,796,112 L1101* probably null Het
Trim43b C T 9: 89,091,480 D67N probably benign Het
Ubn2 T A 6: 38,463,726 C178S probably benign Het
Vmn1r54 T C 6: 90,269,325 F74L probably benign Het
Vmn2r24 A G 6: 123,779,185 H72R probably benign Het
Wdr66 G A 5: 123,287,305 V776I probably benign Het
Wnk1 C T 6: 119,952,771 V850I probably benign Het
Zan T G 5: 137,456,285 Y1419S unknown Het
Zbtb14 T A 17: 69,387,582 Y92N probably damaging Het
Zfand5 A G 19: 21,277,737 K116E probably benign Het
Zfhx3 A G 8: 108,947,961 E1881G possibly damaging Het
Zfp280b A G 10: 76,039,090 K268E probably benign Het
Zfp541 A G 7: 16,079,110 I563V probably benign Het
Zfy2 T A Y: 2,106,334 I767L probably benign Het
Other mutations in Oas3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Oas3 APN 5 120777442 splice site probably benign
IGL01095:Oas3 APN 5 120772889 missense probably damaging 1.00
IGL01835:Oas3 APN 5 120766128 nonsense probably null
IGL02006:Oas3 APN 5 120769235 missense probably benign 0.00
IGL02811:Oas3 APN 5 120764322 missense unknown
IGL03194:Oas3 APN 5 120758953 missense probably damaging 1.00
R0066:Oas3 UTSW 5 120758875 missense probably damaging 1.00
R0195:Oas3 UTSW 5 120756145 missense probably damaging 1.00
R0196:Oas3 UTSW 5 120756145 missense probably damaging 1.00
R0197:Oas3 UTSW 5 120756145 missense probably damaging 1.00
R0445:Oas3 UTSW 5 120756145 missense probably damaging 1.00
R0523:Oas3 UTSW 5 120766144 missense unknown
R0592:Oas3 UTSW 5 120771149 missense probably damaging 1.00
R0946:Oas3 UTSW 5 120769063 missense unknown
R1354:Oas3 UTSW 5 120770000 missense possibly damaging 0.94
R1642:Oas3 UTSW 5 120777574 missense possibly damaging 0.90
R1681:Oas3 UTSW 5 120769908 missense probably benign 0.22
R1844:Oas3 UTSW 5 120759980 missense probably damaging 0.99
R1981:Oas3 UTSW 5 120761835 splice site probably benign
R2443:Oas3 UTSW 5 120777488 missense probably benign 0.35
R2902:Oas3 UTSW 5 120758917 missense probably damaging 1.00
R3034:Oas3 UTSW 5 120771056 missense probably damaging 1.00
R4565:Oas3 UTSW 5 120771039 missense probably damaging 1.00
R4692:Oas3 UTSW 5 120769355 missense probably benign 0.03
R4723:Oas3 UTSW 5 120766256 missense unknown
R5288:Oas3 UTSW 5 120756990 missense probably damaging 1.00
R5343:Oas3 UTSW 5 120756238 missense possibly damaging 0.70
R5494:Oas3 UTSW 5 120761644 missense unknown
R5688:Oas3 UTSW 5 120758802 missense probably benign 0.31
R5894:Oas3 UTSW 5 120756954 missense probably damaging 1.00
R5921:Oas3 UTSW 5 120769981 missense probably damaging 1.00
R6037:Oas3 UTSW 5 120769319 missense probably benign 0.41
R6037:Oas3 UTSW 5 120769319 missense probably benign 0.41
R6066:Oas3 UTSW 5 120772924 missense probably damaging 0.97
R6104:Oas3 UTSW 5 120761693 missense unknown
R6134:Oas3 UTSW 5 120769048 missense unknown
R6255:Oas3 UTSW 5 120771230 missense probably benign 0.04
R6257:Oas3 UTSW 5 120761135 unclassified probably benign
R6776:Oas3 UTSW 5 120758874 missense probably damaging 1.00
R8022:Oas3 UTSW 5 120756966 missense possibly damaging 0.91
R8137:Oas3 UTSW 5 120777500 missense probably benign 0.07
RF006:Oas3 UTSW 5 120774100 missense probably damaging 1.00
X0024:Oas3 UTSW 5 120761728 missense unknown
Predicted Primers PCR Primer
(F):5'- TGGGGCCTTACATAGAGATGAG -3'
(R):5'- GCTCAGAACTGACTGTCCTTCC -3'

Sequencing Primer
(F):5'- TACGCGTGCTCATATACAGATC -3'
(R):5'- GAACTGACTGTCCTTCCTGCCTC -3'
Posted On2016-02-04