Incidental Mutation 'R4812:Kmt2a'
ID369557
Institutional Source Beutler Lab
Gene Symbol Kmt2a
Ensembl Gene ENSMUSG00000002028
Gene Namelysine (K)-specific methyltransferase 2A
SynonymsMll1, HTRX1, ALL-1, Cxxc7, trithorax Drosophila, Mll, All1
MMRRC Submission 042431-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4812 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location44803355-44881296 bp(-) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) A to T at 44831354 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000002095] [ENSMUST00000114689]
Predicted Effect unknown
Transcript: ENSMUST00000002095
AA Change: I1679K
SMART Domains Protein: ENSMUSP00000002095
Gene: ENSMUSG00000002028
AA Change: I1679K

DomainStartEndE-ValueType
low complexity region 14 29 N/A INTRINSIC
low complexity region 41 102 N/A INTRINSIC
PDB:3U88|N 103 151 6e-15 PDB
AT_hook 171 183 2.12e2 SMART
AT_hook 217 229 4.68e1 SMART
AT_hook 298 310 2.8e0 SMART
coiled coil region 366 394 N/A INTRINSIC
low complexity region 450 489 N/A INTRINSIC
low complexity region 524 535 N/A INTRINSIC
low complexity region 544 574 N/A INTRINSIC
low complexity region 589 601 N/A INTRINSIC
low complexity region 660 674 N/A INTRINSIC
low complexity region 717 732 N/A INTRINSIC
low complexity region 760 790 N/A INTRINSIC
low complexity region 866 892 N/A INTRINSIC
low complexity region 989 1005 N/A INTRINSIC
Pfam:zf-CXXC 1144 1191 1.1e-15 PFAM
low complexity region 1204 1233 N/A INTRINSIC
low complexity region 1236 1283 N/A INTRINSIC
low complexity region 1295 1316 N/A INTRINSIC
low complexity region 1323 1345 N/A INTRINSIC
low complexity region 1353 1366 N/A INTRINSIC
PHD 1432 1479 5.57e-3 SMART
PHD 1480 1530 1.17e-10 SMART
PHD 1567 1624 7.94e-8 SMART
BROMO 1632 1766 2.24e-10 SMART
low complexity region 1816 1850 N/A INTRINSIC
PHD 1931 1977 1.74e-4 SMART
low complexity region 1990 2001 N/A INTRINSIC
FYRN 2029 2072 2.33e-20 SMART
low complexity region 2180 2194 N/A INTRINSIC
low complexity region 2215 2227 N/A INTRINSIC
low complexity region 2607 2618 N/A INTRINSIC
low complexity region 2789 2800 N/A INTRINSIC
low complexity region 2824 2833 N/A INTRINSIC
low complexity region 2856 2878 N/A INTRINSIC
low complexity region 2902 2909 N/A INTRINSIC
low complexity region 3115 3141 N/A INTRINSIC
low complexity region 3164 3175 N/A INTRINSIC
low complexity region 3228 3239 N/A INTRINSIC
low complexity region 3299 3312 N/A INTRINSIC
low complexity region 3342 3351 N/A INTRINSIC
low complexity region 3405 3419 N/A INTRINSIC
low complexity region 3498 3526 N/A INTRINSIC
low complexity region 3620 3633 N/A INTRINSIC
FYRC 3662 3747 8.54e-37 SMART
SET 3823 3945 6.09e-45 SMART
PostSET 3947 3963 1.65e-4 SMART
Predicted Effect unknown
Transcript: ENSMUST00000114689
AA Change: I1682K
SMART Domains Protein: ENSMUSP00000110337
Gene: ENSMUSG00000002028
AA Change: I1682K

DomainStartEndE-ValueType
low complexity region 14 29 N/A INTRINSIC
low complexity region 41 102 N/A INTRINSIC
PDB:3U88|N 103 151 6e-15 PDB
AT_hook 171 183 2.12e2 SMART
AT_hook 217 229 4.68e1 SMART
AT_hook 298 310 2.8e0 SMART
coiled coil region 366 394 N/A INTRINSIC
low complexity region 450 489 N/A INTRINSIC
low complexity region 524 535 N/A INTRINSIC
low complexity region 544 574 N/A INTRINSIC
low complexity region 589 601 N/A INTRINSIC
low complexity region 660 674 N/A INTRINSIC
low complexity region 717 732 N/A INTRINSIC
low complexity region 760 790 N/A INTRINSIC
low complexity region 866 892 N/A INTRINSIC
low complexity region 989 1005 N/A INTRINSIC
Pfam:zf-CXXC 1144 1191 1.1e-15 PFAM
low complexity region 1204 1233 N/A INTRINSIC
low complexity region 1236 1283 N/A INTRINSIC
low complexity region 1295 1316 N/A INTRINSIC
low complexity region 1323 1345 N/A INTRINSIC
low complexity region 1353 1366 N/A INTRINSIC
PHD 1432 1479 5.57e-3 SMART
PHD 1480 1530 1.17e-10 SMART
PHD 1567 1627 9.12e-8 SMART
BROMO 1635 1769 2.24e-10 SMART
low complexity region 1819 1853 N/A INTRINSIC
PHD 1934 1980 1.74e-4 SMART
low complexity region 1993 2004 N/A INTRINSIC
FYRN 2032 2075 2.33e-20 SMART
low complexity region 2183 2197 N/A INTRINSIC
low complexity region 2218 2230 N/A INTRINSIC
low complexity region 2610 2621 N/A INTRINSIC
low complexity region 2792 2803 N/A INTRINSIC
low complexity region 2827 2836 N/A INTRINSIC
low complexity region 2859 2881 N/A INTRINSIC
low complexity region 2905 2912 N/A INTRINSIC
low complexity region 3118 3144 N/A INTRINSIC
low complexity region 3167 3178 N/A INTRINSIC
low complexity region 3231 3242 N/A INTRINSIC
low complexity region 3302 3315 N/A INTRINSIC
low complexity region 3345 3354 N/A INTRINSIC
low complexity region 3408 3422 N/A INTRINSIC
low complexity region 3501 3529 N/A INTRINSIC
low complexity region 3623 3636 N/A INTRINSIC
FYRC 3665 3750 8.54e-37 SMART
SET 3826 3948 6.09e-45 SMART
PostSET 3950 3966 1.65e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152241
Meta Mutation Damage Score 0.0638 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 93% (124/133)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcriptional coactivator that plays an essential role in regulating gene expression during early development and hematopoiesis. The encoded protein contains multiple conserved functional domains. One of these domains, the SET domain, is responsible for its histone H3 lysine 4 (H3K4) methyltransferase activity which mediates chromatin modifications associated with epigenetic transcriptional activation. This protein is processed by the enzyme Taspase 1 into two fragments, MLL-C and MLL-N. These fragments reassociate and further assemble into different multiprotein complexes that regulate the transcription of specific target genes, including many of the HOX genes. Multiple chromosomal translocations involving this gene are the cause of certain acute lymphoid leukemias and acute myeloid leukemias. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Oct 2010]
PHENOTYPE: Homozygotes for targeted null mutations die at embryonic day 11.5-14.5 with edematous bodies, petechiae, and hematopoietic insufficiency. Heterozygotes show reduced growth, hematopoietic abnormalities, and homeotic transformations of the axial skeleton. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 128 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017G19Rik C T 3: 40,521,484 noncoding transcript Het
2410089E03Rik T G 15: 8,201,123 probably null Het
Abca5 T C 11: 110,301,821 D681G probably damaging Het
Actl11 T C 9: 107,931,130 V884A probably damaging Het
Akr1c14 G A 13: 4,079,165 V187M probably damaging Het
Apbb1 A T 7: 105,574,025 N126K probably damaging Het
Armc4 T G 18: 7,288,634 T78P possibly damaging Het
Bmt2 G T 6: 13,677,800 R12S unknown Het
Btrc G A 19: 45,423,164 C9Y possibly damaging Het
C5ar1 A C 7: 16,248,333 probably null Het
C8a C T 4: 104,862,591 probably null Het
Cabin1 A G 10: 75,646,594 S2172P possibly damaging Het
Calcoco2 T C 11: 96,107,450 D49G probably damaging Het
Camta1 C T 4: 151,131,542 D974N probably null Het
Car6 T C 4: 150,197,415 E47G probably damaging Het
Ccdc105 T C 10: 78,749,216 H262R probably benign Het
Ccnd3 G A 17: 47,597,580 probably null Het
Celf5 A T 10: 81,470,739 V30E probably damaging Het
Cfap46 T A 7: 139,636,000 D1513V probably damaging Het
Cinp T C 12: 110,879,740 Y84C probably damaging Het
Cnih1 A G 14: 46,776,544 I154T probably damaging Het
Col15a1 C T 4: 47,262,479 P511L possibly damaging Het
Col4a4 C T 1: 82,462,153 V1364M unknown Het
Crtam A G 9: 40,984,325 L38P probably damaging Het
Ctnna1 T A 18: 35,239,477 V495D probably damaging Het
Cubn T C 2: 13,459,076 Y606C probably damaging Het
Cyp4f16 C T 17: 32,546,678 A345V probably null Het
Dctn1 A T 6: 83,189,937 M160L probably benign Het
Dip2c T A 13: 9,637,130 C366* probably null Het
Dnajc2 G A 5: 21,763,486 S401L probably benign Het
Dnmt3l A G 10: 78,057,294 I302V probably benign Het
Dvl2 T C 11: 70,011,293 probably benign Het
Edn1 T G 13: 42,303,640 S50A probably benign Het
Efhc1 A T 1: 20,990,647 R636W probably damaging Het
Epg5 T A 18: 77,979,184 H1047Q probably benign Het
Etv1 T G 12: 38,861,288 V371G probably damaging Het
Fam71e2 G A 7: 4,759,072 T295M probably damaging Het
Fap T A 2: 62,519,021 I475F probably damaging Het
Fbxw15 T C 9: 109,559,922 I140V probably benign Het
Fer A G 17: 63,934,297 T311A probably benign Het
Fh1 A G 1: 175,601,459 W497R probably damaging Het
Flot2 T A 11: 78,053,365 L45Q probably damaging Het
Flt1 C A 5: 147,683,939 A132S probably benign Het
Fmnl1 T C 11: 103,198,564 probably benign Het
Ggta1 C T 2: 35,402,723 V203I probably benign Het
Gm19345 C T 7: 19,857,873 V204M probably damaging Het
Gm4204 T A 1: 135,232,489 noncoding transcript Het
Gm6124 C G 7: 39,222,895 noncoding transcript Het
Gprin3 T A 6: 59,353,365 K652N possibly damaging Het
Gucy1b2 T C 14: 62,415,897 probably null Het
Hace1 C A 10: 45,686,603 A738E probably benign Het
Hectd1 C T 12: 51,827,351 probably null Het
Hnrnpdl T C 5: 100,036,472 probably benign Het
Hyou1 T C 9: 44,387,121 probably benign Het
Ifi44l G A 3: 151,759,699 A138V probably benign Het
Igkv16-104 A T 6: 68,425,845 I41F possibly damaging Het
Ints7 T A 1: 191,594,430 D171E possibly damaging Het
Kmt2e T C 5: 23,502,587 V1716A possibly damaging Het
Krtap5-1 G A 7: 142,296,891 S60F unknown Het
Lama4 G A 10: 39,072,769 V843I probably benign Het
Laptm5 A G 4: 130,913,438 probably null Het
Lbhd1 G A 19: 8,889,174 A193T probably damaging Het
Lce3f C T 3: 92,992,940 P23S unknown Het
Lrmp G A 6: 145,148,011 G120S probably damaging Het
Mecom A C 3: 30,140,368 M1R probably null Het
Mindy4 A C 6: 55,279,103 T531P possibly damaging Het
Mrpl3 A G 9: 105,073,824 N263S probably damaging Het
Myo18b T C 5: 112,809,718 K1460E possibly damaging Het
Myof A G 19: 37,916,559 Y852H probably damaging Het
Nefl T G 14: 68,084,285 V108G probably damaging Het
Nid1 T A 13: 13,506,468 L1061* probably null Het
Nim1k T A 13: 119,712,384 M325L probably benign Het
Nlrp1c-ps T C 11: 71,252,305 noncoding transcript Het
Npsr1 C T 9: 24,289,956 T59I probably damaging Het
Nr2c1 A G 10: 94,188,252 T440A probably benign Het
Nup160 C T 2: 90,725,691 T1245I probably damaging Het
Nup88 T A 11: 70,965,726 T194S probably damaging Het
Oas3 A G 5: 120,761,147 probably benign Het
Olfr1129 A G 2: 87,575,743 I220V probably benign Het
Olfr1274-ps T A 2: 90,401,096 M145K probably benign Het
Olfr1393 T A 11: 49,280,457 I103K possibly damaging Het
Opn1sw A T 6: 29,378,039 M252K probably damaging Het
Oprm1 T G 10: 6,832,698 probably benign Het
Pcdha2 T A 18: 36,939,808 V164E probably benign Het
Pclo A G 5: 14,540,025 T780A unknown Het
Pcnx2 T A 8: 125,865,939 Q762L probably benign Het
Pcyt2 A T 11: 120,614,425 probably benign Het
Pdpr A G 8: 111,116,717 N294D probably benign Het
Perm1 T A 4: 156,218,736 V579E possibly damaging Het
Pgk2 T A 17: 40,207,390 K382N possibly damaging Het
Plcb4 T A 2: 136,007,881 L205Q probably damaging Het
Plekha3 C T 2: 76,686,631 T109I probably damaging Het
Pnn T A 12: 59,071,618 V329E possibly damaging Het
Ptpn13 A G 5: 103,523,615 I469M probably benign Het
Rapgef3 A G 15: 97,753,803 V603A probably benign Het
Rbms1 C T 2: 60,792,769 V75I possibly damaging Het
Rbp3 T A 14: 33,954,774 D226E probably damaging Het
Robo2 A T 16: 73,916,288 N1189K probably benign Het
Rragd A G 4: 33,018,766 T270A probably benign Het
Rxfp1 T A 3: 79,650,582 T530S probably benign Het
Ryr3 T C 2: 112,912,236 E479G probably damaging Het
Scd2 A T 19: 44,301,402 I279F probably damaging Het
Sh3d19 A T 3: 86,123,767 D746V probably damaging Het
Shroom4 A G X: 6,624,126 K1133E probably benign Het
Sirpb1c A G 3: 15,833,222 V151A probably damaging Het
Slc26a2 A T 18: 61,202,021 I120N probably damaging Het
Slco1a1 A G 6: 141,918,593 S494P probably damaging Het
Srebf2 A T 15: 82,203,825 T1061S probably damaging Het
Sspo T C 6: 48,490,510 L4202P probably benign Het
Synj2 G A 17: 6,010,664 G215E probably damaging Het
Tbc1d19 T C 5: 53,809,806 V16A probably damaging Het
Tiparp T C 3: 65,552,769 I495T possibly damaging Het
Tipin A G 9: 64,304,412 H260R probably benign Het
Tle1 A G 4: 72,145,354 S221P probably damaging Het
Tmem94 T A 11: 115,796,112 L1101* probably null Het
Trim43b C T 9: 89,091,480 D67N probably benign Het
Ubn2 T A 6: 38,463,726 C178S probably benign Het
Vmn1r54 T C 6: 90,269,325 F74L probably benign Het
Vmn2r24 A G 6: 123,779,185 H72R probably benign Het
Wdr66 G A 5: 123,287,305 V776I probably benign Het
Wnk1 C T 6: 119,952,771 V850I probably benign Het
Zan T G 5: 137,456,285 Y1419S unknown Het
Zbtb14 T A 17: 69,387,582 Y92N probably damaging Het
Zfand5 A G 19: 21,277,737 K116E probably benign Het
Zfhx3 A G 8: 108,947,961 E1881G possibly damaging Het
Zfp280b A G 10: 76,039,090 K268E probably benign Het
Zfp541 A G 7: 16,079,110 I563V probably benign Het
Zfy2 T A Y: 2,106,334 I767L probably benign Het
Other mutations in Kmt2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Kmt2a APN 9 44807934 unclassified probably benign
IGL00667:Kmt2a APN 9 44824386 utr 3 prime probably benign
IGL00828:Kmt2a APN 9 44820776 unclassified probably benign
IGL01080:Kmt2a APN 9 44809092 missense unknown
IGL01131:Kmt2a APN 9 44821170 unclassified probably benign
IGL01294:Kmt2a APN 9 44820297 unclassified probably benign
IGL01432:Kmt2a APN 9 44809096 missense unknown
IGL01646:Kmt2a APN 9 44825484 utr 3 prime probably benign
IGL01777:Kmt2a APN 9 44849005 missense probably damaging 0.99
IGL01944:Kmt2a APN 9 44849767 missense probably damaging 1.00
IGL02125:Kmt2a APN 9 44848686 missense probably damaging 1.00
IGL02207:Kmt2a APN 9 44847682 missense probably damaging 0.98
IGL02424:Kmt2a APN 9 44824635 utr 3 prime probably benign
IGL02499:Kmt2a APN 9 44830509 splice site probably benign
IGL02574:Kmt2a APN 9 44830513 splice site probably benign
IGL02711:Kmt2a APN 9 44824523 splice site probably benign
IGL02828:Kmt2a APN 9 44821947 unclassified probably benign
IGL03012:Kmt2a APN 9 44810966 unclassified probably benign
IGL03242:Kmt2a APN 9 44848392 missense probably damaging 0.99
IGL03294:Kmt2a APN 9 44820565 unclassified probably benign
IGL03326:Kmt2a APN 9 44818747 nonsense probably null
Chromas UTSW 9 44820342 unclassified probably benign
Heteros UTSW 9 44828811 nonsense probably null
Pyknos UTSW 9 44826828 utr 3 prime probably benign
Skies UTSW 9 44829261 utr 3 prime probably benign
spacious UTSW 9 44847645 missense probably benign 0.03
PIT4402001:Kmt2a UTSW 9 44841062 missense unknown
R0076:Kmt2a UTSW 9 44830059 utr 3 prime probably benign
R0076:Kmt2a UTSW 9 44830059 utr 3 prime probably benign
R0180:Kmt2a UTSW 9 44826851 utr 3 prime probably benign
R0363:Kmt2a UTSW 9 44809713 critical splice donor site probably null
R0411:Kmt2a UTSW 9 44819964 unclassified probably benign
R0555:Kmt2a UTSW 9 44847571 missense probably damaging 1.00
R0587:Kmt2a UTSW 9 44847534 missense probably damaging 0.99
R0865:Kmt2a UTSW 9 44818770 unclassified probably benign
R0988:Kmt2a UTSW 9 44848549 missense probably benign 0.03
R1006:Kmt2a UTSW 9 44847696 missense probably damaging 0.99
R1108:Kmt2a UTSW 9 44849062 missense probably damaging 1.00
R1292:Kmt2a UTSW 9 44814694 utr 3 prime probably benign
R1322:Kmt2a UTSW 9 44821121 unclassified probably benign
R1476:Kmt2a UTSW 9 44824635 utr 3 prime probably benign
R1485:Kmt2a UTSW 9 44826928 utr 3 prime probably benign
R1487:Kmt2a UTSW 9 44833990 utr 3 prime probably benign
R1493:Kmt2a UTSW 9 44846905 missense probably damaging 1.00
R1499:Kmt2a UTSW 9 44848266 missense probably benign 0.36
R1507:Kmt2a UTSW 9 44818403 unclassified probably benign
R1603:Kmt2a UTSW 9 44841561 unclassified probably null
R1635:Kmt2a UTSW 9 44824369 utr 3 prime probably benign
R1662:Kmt2a UTSW 9 44836670 utr 3 prime probably benign
R1711:Kmt2a UTSW 9 44841621 missense unknown
R1785:Kmt2a UTSW 9 44819675 unclassified probably benign
R1786:Kmt2a UTSW 9 44819675 unclassified probably benign
R1919:Kmt2a UTSW 9 44820345 unclassified probably benign
R1964:Kmt2a UTSW 9 44820644 missense probably benign 0.23
R1965:Kmt2a UTSW 9 44821460 unclassified probably benign
R2029:Kmt2a UTSW 9 44818450 missense probably benign 0.23
R2054:Kmt2a UTSW 9 44823374 utr 3 prime probably benign
R2259:Kmt2a UTSW 9 44881142 unclassified probably benign
R2382:Kmt2a UTSW 9 44820910 unclassified probably benign
R2483:Kmt2a UTSW 9 44848966 missense probably damaging 0.99
R3033:Kmt2a UTSW 9 44821863 unclassified probably benign
R3423:Kmt2a UTSW 9 44820097 unclassified probably benign
R3428:Kmt2a UTSW 9 44848119 missense probably benign 0.06
R3605:Kmt2a UTSW 9 44849196 missense probably damaging 1.00
R3607:Kmt2a UTSW 9 44849196 missense probably damaging 1.00
R3611:Kmt2a UTSW 9 44822466 unclassified probably benign
R3623:Kmt2a UTSW 9 44848966 missense probably damaging 0.99
R3745:Kmt2a UTSW 9 44831340 utr 3 prime probably benign
R3806:Kmt2a UTSW 9 44820356 unclassified probably benign
R3841:Kmt2a UTSW 9 44831291 utr 3 prime probably benign
R3855:Kmt2a UTSW 9 44830499 utr 3 prime probably benign
R4027:Kmt2a UTSW 9 44836693 utr 3 prime probably benign
R4124:Kmt2a UTSW 9 44819796 unclassified probably benign
R4177:Kmt2a UTSW 9 44820983 unclassified probably benign
R4296:Kmt2a UTSW 9 44821175 unclassified probably benign
R4414:Kmt2a UTSW 9 44809780 unclassified probably benign
R4461:Kmt2a UTSW 9 44848966 missense probably damaging 0.99
R4668:Kmt2a UTSW 9 44824572 utr 3 prime probably benign
R4761:Kmt2a UTSW 9 44849124 missense probably damaging 1.00
R4815:Kmt2a UTSW 9 44821256 unclassified probably benign
R4817:Kmt2a UTSW 9 44821466 unclassified probably benign
R4888:Kmt2a UTSW 9 44821680 unclassified probably benign
R4958:Kmt2a UTSW 9 44848467 missense probably damaging 1.00
R5055:Kmt2a UTSW 9 44818352 unclassified probably benign
R5065:Kmt2a UTSW 9 44842700 unclassified probably benign
R5185:Kmt2a UTSW 9 44820246 unclassified probably benign
R5358:Kmt2a UTSW 9 44819274 unclassified probably benign
R5411:Kmt2a UTSW 9 44848485 missense probably damaging 1.00
R5420:Kmt2a UTSW 9 44848336 missense probably damaging 1.00
R5483:Kmt2a UTSW 9 44824624 utr 3 prime probably benign
R5487:Kmt2a UTSW 9 44821975 unclassified probably benign
R5488:Kmt2a UTSW 9 44841038 utr 3 prime probably benign
R5489:Kmt2a UTSW 9 44841038 utr 3 prime probably benign
R5538:Kmt2a UTSW 9 44820342 unclassified probably benign
R5576:Kmt2a UTSW 9 44842634 missense possibly damaging 0.94
R5631:Kmt2a UTSW 9 44820688 unclassified probably benign
R5781:Kmt2a UTSW 9 44847842 nonsense probably null
R5789:Kmt2a UTSW 9 44819904 unclassified probably benign
R5932:Kmt2a UTSW 9 44820647 unclassified probably benign
R6027:Kmt2a UTSW 9 44819290 unclassified probably benign
R6191:Kmt2a UTSW 9 44826828 utr 3 prime probably benign
R6239:Kmt2a UTSW 9 44819796 unclassified probably benign
R6291:Kmt2a UTSW 9 44832874 utr 3 prime probably benign
R6344:Kmt2a UTSW 9 44821859 unclassified probably benign
R6611:Kmt2a UTSW 9 44849272 missense probably damaging 0.98
R6641:Kmt2a UTSW 9 44819835 unclassified probably benign
R6651:Kmt2a UTSW 9 44828811 nonsense probably null
R6825:Kmt2a UTSW 9 44818407 unclassified probably benign
R6853:Kmt2a UTSW 9 44818407 unclassified probably benign
R6897:Kmt2a UTSW 9 44847645 missense probably benign 0.03
R6930:Kmt2a UTSW 9 44842665 unclassified probably benign
R6932:Kmt2a UTSW 9 44829261 utr 3 prime probably benign
R6957:Kmt2a UTSW 9 44820022 unclassified probably benign
R7170:Kmt2a UTSW 9 44810721 missense unknown
R7202:Kmt2a UTSW 9 44847715 missense probably benign 0.03
R7481:Kmt2a UTSW 9 44809071 missense unknown
R7538:Kmt2a UTSW 9 44847744 missense probably damaging 0.99
R7597:Kmt2a UTSW 9 44831353 missense unknown
X0021:Kmt2a UTSW 9 44831235 utr 3 prime probably benign
X0025:Kmt2a UTSW 9 44825392 nonsense probably null
X0026:Kmt2a UTSW 9 44820906 unclassified probably benign
X0027:Kmt2a UTSW 9 44880896 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- GATCCTGAAGCTACATGACACCTC -3'
(R):5'- ACTCCTGTTTAAGAACTCTCTGGC -3'

Sequencing Primer
(F):5'- CAGCTGTACTTCTAAAGAGCCAAGG -3'
(R):5'- AAGAACTCTCTGGCATTTTCATG -3'
Posted On2016-02-04