Incidental Mutation 'R0420:Zc3h6'
ID 36962
Institutional Source Beutler Lab
Gene Symbol Zc3h6
Ensembl Gene ENSMUSG00000042851
Gene Name zinc finger CCCH type containing 6
Synonyms 4631426G04Rik, 4833425H18Rik
MMRRC Submission 038622-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.197) question?
Stock # R0420 (G1)
Quality Score 174
Status Validated
Chromosome 2
Chromosomal Location 128809322-128860483 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 128856747 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 609 (D609G)
Ref Sequence ENSEMBL: ENSMUSP00000105949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110320]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000110320
AA Change: D609G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000105949
Gene: ENSMUSG00000042851
AA Change: D609G

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
coiled coil region 30 71 N/A INTRINSIC
low complexity region 74 88 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
ZnF_C3H1 271 296 1.72e-4 SMART
ZnF_C3H1 300 325 2.51e-6 SMART
ZnF_C3H1 326 349 5.24e0 SMART
coiled coil region 351 383 N/A INTRINSIC
low complexity region 385 400 N/A INTRINSIC
low complexity region 493 509 N/A INTRINSIC
low complexity region 698 707 N/A INTRINSIC
low complexity region 784 798 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
low complexity region 876 890 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135186
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.2%
Validation Efficiency 100% (76/76)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 T C 5: 8,991,050 (GRCm39) V870A probably benign Het
Adam6b A T 12: 113,453,614 (GRCm39) M144L probably benign Het
Adrb2 T A 18: 62,312,610 (GRCm39) I72L possibly damaging Het
Ankrd53 A T 6: 83,740,674 (GRCm39) H99L probably damaging Het
Ap4e1 C T 2: 126,891,280 (GRCm39) T17M probably damaging Het
Arnt T A 3: 95,377,705 (GRCm39) probably benign Het
Atp1a3 C T 7: 24,680,052 (GRCm39) G884E probably benign Het
Atp6v1b1 T C 6: 83,729,826 (GRCm39) probably benign Het
Atp8a2 G T 14: 60,011,193 (GRCm39) T971K probably damaging Het
BC048562 A T 9: 108,323,165 (GRCm39) T167S probably benign Het
Brd9 A G 13: 74,103,592 (GRCm39) M491V probably benign Het
Btnl10 A T 11: 58,814,277 (GRCm39) D319V probably damaging Het
Cadps T A 14: 12,491,800 (GRCm38) R783S probably damaging Het
Ccdc149 A G 5: 52,557,581 (GRCm39) probably benign Het
Ccm2l A T 2: 152,912,782 (GRCm39) D107V probably null Het
Cep192 A G 18: 67,946,964 (GRCm39) E213G possibly damaging Het
Cyp2c37 A C 19: 39,984,238 (GRCm39) N242T probably benign Het
Dnah17 A G 11: 117,930,765 (GRCm39) V3750A probably damaging Het
Ehbp1 T A 11: 22,101,836 (GRCm39) I231L probably benign Het
Emilin3 A G 2: 160,752,799 (GRCm39) probably benign Het
Eya4 T C 10: 23,031,861 (GRCm39) N254S possibly damaging Het
Fam184b A G 5: 45,741,854 (GRCm39) S126P probably damaging Het
Fancd2 T C 6: 113,513,940 (GRCm39) L108P probably damaging Het
Fgf12 A T 16: 27,981,281 (GRCm39) M145K possibly damaging Het
Gabbr1 A G 17: 37,357,654 (GRCm39) N23S possibly damaging Het
Ggt1 T A 10: 75,412,047 (GRCm39) probably benign Het
Gm6434 T A 7: 25,581,786 (GRCm39) noncoding transcript Het
Grik4 A T 9: 42,533,392 (GRCm39) L376* probably null Het
Gvin3 T A 7: 106,203,090 (GRCm39) L51F probably damaging Het
Gzf1 A G 2: 148,525,753 (GRCm39) T75A probably benign Het
Hcn1 T C 13: 118,111,911 (GRCm39) I625T unknown Het
Hhat C T 1: 192,235,242 (GRCm39) probably null Het
Ifit1bl1 T C 19: 34,571,914 (GRCm39) E181G probably damaging Het
Kif21a T C 15: 90,852,257 (GRCm39) probably benign Het
Lrrc45 A C 11: 120,606,045 (GRCm39) S118R probably damaging Het
Mcm9 T C 10: 53,424,623 (GRCm39) I656V probably benign Het
Ms4a5 A G 19: 11,261,018 (GRCm39) L47S probably damaging Het
Mynn A T 3: 30,661,608 (GRCm39) N230I probably benign Het
Nck2 T C 1: 43,593,278 (GRCm39) S162P probably damaging Het
Nfat5 T C 8: 108,094,093 (GRCm39) F259S probably damaging Het
Obox1 T G 7: 15,290,178 (GRCm39) S174A possibly damaging Het
Ociad1 T A 5: 73,470,772 (GRCm39) probably null Het
Pgbd1 A T 13: 21,607,336 (GRCm39) V286E possibly damaging Het
Phlpp2 T C 8: 110,666,567 (GRCm39) V1032A probably damaging Het
Ppm1e C T 11: 87,131,440 (GRCm39) A318T probably damaging Het
Prex1 T A 2: 166,431,491 (GRCm39) D757V probably benign Het
Ptpdc1 C A 13: 48,742,595 (GRCm39) probably null Het
Rbbp5 T G 1: 132,421,582 (GRCm39) I94R possibly damaging Het
Rnpc3 A G 3: 113,415,518 (GRCm39) V173A probably benign Het
Sgsm1 A T 5: 113,411,625 (GRCm39) N700K probably benign Het
Slco1a8 T G 6: 141,931,203 (GRCm39) probably benign Het
Sox14 T A 9: 99,757,175 (GRCm39) H188L probably damaging Het
Spmip11 A G 15: 98,468,975 (GRCm39) S17G probably benign Het
Supt5 T A 7: 28,016,754 (GRCm39) probably benign Het
Synpo A G 18: 60,735,490 (GRCm39) S819P probably damaging Het
Tenm2 A G 11: 36,097,951 (GRCm39) probably benign Het
Tenm4 T C 7: 96,522,973 (GRCm39) V1468A possibly damaging Het
Tiam2 A G 17: 3,553,193 (GRCm39) N83S probably benign Het
Tle6 T C 10: 81,431,145 (GRCm39) probably benign Het
Tm2d2 T G 8: 25,508,130 (GRCm39) N91K probably damaging Het
Tmem132d T G 5: 127,941,710 (GRCm39) Q463H probably benign Het
Tmf1 A G 6: 97,153,102 (GRCm39) S324P probably damaging Het
Tnc T C 4: 63,918,396 (GRCm39) T1172A probably benign Het
Usp17lb A T 7: 104,489,746 (GRCm39) C393S probably benign Het
Usp42 G A 5: 143,700,616 (GRCm39) L1136F probably damaging Het
Vmn2r92 T G 17: 18,389,183 (GRCm39) M499R probably benign Het
Vps54 T A 11: 21,261,071 (GRCm39) probably benign Het
Wdr6 C T 9: 108,450,300 (GRCm39) R1076H probably benign Het
Wdr72 T A 9: 74,118,039 (GRCm39) M917K possibly damaging Het
Wee2 T C 6: 40,433,929 (GRCm39) V281A probably benign Het
Zfp345 G A 2: 150,315,163 (GRCm39) H125Y possibly damaging Het
Zhx2 A G 15: 57,685,236 (GRCm39) K202E probably damaging Het
Zic2 CCCACCACCACCATCACCACCACCACC CCCACCATCACCACCACCACC 14: 122,713,776 (GRCm39) probably benign Het
Other mutations in Zc3h6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01732:Zc3h6 APN 2 128,853,795 (GRCm39) missense probably damaging 1.00
IGL01880:Zc3h6 APN 2 128,859,298 (GRCm39) missense probably damaging 0.99
IGL02160:Zc3h6 APN 2 128,839,605 (GRCm39) missense probably benign 0.02
IGL02161:Zc3h6 APN 2 128,835,146 (GRCm39) missense possibly damaging 0.90
IGL02202:Zc3h6 APN 2 128,858,501 (GRCm39) missense probably damaging 1.00
IGL02547:Zc3h6 APN 2 128,857,531 (GRCm39) missense probably benign 0.00
IGL02973:Zc3h6 APN 2 128,839,715 (GRCm39) missense probably damaging 0.98
BB001:Zc3h6 UTSW 2 128,857,400 (GRCm39) missense possibly damaging 0.52
BB011:Zc3h6 UTSW 2 128,857,400 (GRCm39) missense possibly damaging 0.52
R0336:Zc3h6 UTSW 2 128,857,332 (GRCm39) missense possibly damaging 0.81
R0538:Zc3h6 UTSW 2 128,859,143 (GRCm39) missense possibly damaging 0.75
R0944:Zc3h6 UTSW 2 128,848,736 (GRCm39) missense probably damaging 1.00
R1151:Zc3h6 UTSW 2 128,859,056 (GRCm39) missense probably benign 0.00
R1528:Zc3h6 UTSW 2 128,858,989 (GRCm39) missense probably benign 0.01
R1698:Zc3h6 UTSW 2 128,859,278 (GRCm39) missense probably benign
R1712:Zc3h6 UTSW 2 128,858,654 (GRCm39) missense probably damaging 1.00
R1913:Zc3h6 UTSW 2 128,858,540 (GRCm39) missense probably damaging 1.00
R1926:Zc3h6 UTSW 2 128,839,715 (GRCm39) missense probably damaging 0.98
R2030:Zc3h6 UTSW 2 128,848,006 (GRCm39) missense probably damaging 1.00
R2051:Zc3h6 UTSW 2 128,857,538 (GRCm39) missense possibly damaging 0.55
R2133:Zc3h6 UTSW 2 128,809,750 (GRCm39) missense possibly damaging 0.53
R2273:Zc3h6 UTSW 2 128,856,629 (GRCm39) missense probably benign 0.01
R2328:Zc3h6 UTSW 2 128,835,122 (GRCm39) missense possibly damaging 0.85
R2862:Zc3h6 UTSW 2 128,857,380 (GRCm39) missense probably benign 0.43
R2899:Zc3h6 UTSW 2 128,844,152 (GRCm39) missense probably benign 0.00
R3711:Zc3h6 UTSW 2 128,859,251 (GRCm39) missense probably benign 0.00
R3743:Zc3h6 UTSW 2 128,839,712 (GRCm39) missense probably damaging 1.00
R3893:Zc3h6 UTSW 2 128,858,060 (GRCm39) missense probably damaging 1.00
R4748:Zc3h6 UTSW 2 128,844,160 (GRCm39) missense probably damaging 1.00
R5025:Zc3h6 UTSW 2 128,852,353 (GRCm39) missense possibly damaging 0.87
R5026:Zc3h6 UTSW 2 128,859,229 (GRCm39) missense probably benign 0.00
R5125:Zc3h6 UTSW 2 128,856,399 (GRCm39) missense possibly damaging 0.93
R5373:Zc3h6 UTSW 2 128,844,076 (GRCm39) missense possibly damaging 0.75
R5374:Zc3h6 UTSW 2 128,844,076 (GRCm39) missense possibly damaging 0.75
R5703:Zc3h6 UTSW 2 128,835,372 (GRCm39) intron probably benign
R5802:Zc3h6 UTSW 2 128,857,479 (GRCm39) missense possibly damaging 0.56
R5876:Zc3h6 UTSW 2 128,835,197 (GRCm39) missense probably benign 0.29
R5879:Zc3h6 UTSW 2 128,839,696 (GRCm39) splice site probably null
R5950:Zc3h6 UTSW 2 128,839,710 (GRCm39) nonsense probably null
R6031:Zc3h6 UTSW 2 128,809,732 (GRCm39) missense possibly damaging 0.85
R6031:Zc3h6 UTSW 2 128,809,732 (GRCm39) missense possibly damaging 0.85
R6781:Zc3h6 UTSW 2 128,857,341 (GRCm39) missense probably damaging 0.99
R7323:Zc3h6 UTSW 2 128,835,331 (GRCm39) missense unknown
R7340:Zc3h6 UTSW 2 128,835,110 (GRCm39) missense possibly damaging 0.90
R7572:Zc3h6 UTSW 2 128,859,172 (GRCm39) missense probably benign 0.02
R7576:Zc3h6 UTSW 2 128,856,473 (GRCm39) missense probably damaging 1.00
R7797:Zc3h6 UTSW 2 128,857,555 (GRCm39) critical splice donor site probably null
R7924:Zc3h6 UTSW 2 128,857,400 (GRCm39) missense possibly damaging 0.52
R8048:Zc3h6 UTSW 2 128,858,934 (GRCm39) missense probably benign 0.30
R8877:Zc3h6 UTSW 2 128,856,319 (GRCm39) nonsense probably null
R9076:Zc3h6 UTSW 2 128,859,096 (GRCm39) nonsense probably null
R9577:Zc3h6 UTSW 2 128,858,102 (GRCm39) missense
R9687:Zc3h6 UTSW 2 128,859,281 (GRCm39) missense probably damaging 1.00
R9745:Zc3h6 UTSW 2 128,859,155 (GRCm39) missense probably benign 0.08
Z1176:Zc3h6 UTSW 2 128,858,141 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGAGAGTCACAGCTCTCCAGCTTC -3'
(R):5'- ACCAAAGTGTAAGGGTCAGAATCGC -3'

Sequencing Primer
(F):5'- GCTTCACTGTACCAGCAAATG -3'
(R):5'- tgggaggcagaggcagg -3'
Posted On 2013-05-09