Incidental Mutation 'R4814:Plekhm2'
ID369625
Institutional Source Beutler Lab
Gene Symbol Plekhm2
Ensembl Gene ENSMUSG00000028917
Gene Namepleckstrin homology domain containing, family M (with RUN domain) member 2
Synonyms2310034J19Rik
MMRRC Submission 042432-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4814 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location141625734-141664899 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 141627839 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 959 (L959P)
Ref Sequence ENSEMBL: ENSMUSP00000081221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030751] [ENSMUST00000038661] [ENSMUST00000084203]
Predicted Effect probably benign
Transcript: ENSMUST00000030751
AA Change: L939P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000030751
Gene: ENSMUSG00000028917
AA Change: L939P

DomainStartEndE-ValueType
RUN 93 156 3.18e-21 SMART
low complexity region 230 246 N/A INTRINSIC
low complexity region 295 307 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
low complexity region 485 495 N/A INTRINSIC
low complexity region 505 538 N/A INTRINSIC
Blast:PH 596 656 7e-31 BLAST
PH 766 869 2.43e-12 SMART
Blast:PH 879 960 6e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000038661
SMART Domains Protein: ENSMUSP00000039188
Gene: ENSMUSG00000040740

DomainStartEndE-ValueType
Pfam:Mito_carr 16 111 2.2e-14 PFAM
Pfam:Mito_carr 113 213 7.6e-18 PFAM
Pfam:Mito_carr 217 314 9.3e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000084203
AA Change: L959P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000081221
Gene: ENSMUSG00000028917
AA Change: L959P

DomainStartEndE-ValueType
RUN 93 156 3.18e-21 SMART
low complexity region 250 266 N/A INTRINSIC
low complexity region 315 327 N/A INTRINSIC
low complexity region 479 489 N/A INTRINSIC
low complexity region 505 515 N/A INTRINSIC
low complexity region 525 558 N/A INTRINSIC
Blast:PH 616 676 7e-31 BLAST
PH 786 889 2.43e-12 SMART
Blast:PH 899 980 6e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136102
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140223
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150229
Meta Mutation Damage Score 0.0834 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds the plus-end directed microtubule motor protein kinesin, together with the lysosomal GTPase Arl8, and is required for lysosomes to distribute away from the microtubule-organizing center. The encoded protein belongs to the multisubunit BLOC-one-related complex that regulates lysosome positioning. It binds a Salmonella effector protein called Salmonella induced filament A and is a critical host determinant in Salmonella pathogenesis. It has a domain architecture consisting of an N-terminal RPIP8, UNC-14, and NESCA (RUN) domain that binds kinesin-1 as well as the lysosomal GTPase Arl8, and a C-terminal pleckstrin homology domain that binds the Salmonella induced filament A effector protein. Naturally occurring mutations in this gene lead to abnormal localization of lysosomes, impaired autophagy flux and are associated with recessive dilated cardiomyopathy and left ventricular noncompaction. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased leukocyte numbers and decreased susceptibility to Salmonella infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp T G 16: 56,650,753 V587G probably benign Het
Abtb2 A G 2: 103,717,287 D1002G probably benign Het
Acap2 A G 16: 31,108,126 S524P probably benign Het
Acsm1 A T 7: 119,655,464 I385L probably benign Het
Adra1a C G 14: 66,638,032 A152G probably benign Het
Agbl4 A T 4: 111,656,368 Y437F possibly damaging Het
Amt A G 9: 108,299,780 T196A probably benign Het
Apobr G A 7: 126,586,687 V457M probably benign Het
Birc6 A G 17: 74,649,672 K3563E probably damaging Het
Cdadc1 AGACGGA AGA 14: 59,568,991 probably null Het
Chrna9 T C 5: 65,977,149 W448R probably damaging Het
Cyp4a31 A T 4: 115,570,269 D224V probably damaging Het
Ddx10 C A 9: 53,204,105 R643L possibly damaging Het
Dip2c A G 13: 9,536,860 H200R probably benign Het
Dnah8 A T 17: 30,767,924 R3182S probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Egfr T C 11: 16,869,354 C295R probably damaging Het
Garem1 A T 18: 21,148,116 N394K probably damaging Het
Gcat T C 15: 79,031,122 probably null Het
Gckr C T 5: 31,298,300 Q66* probably null Het
Gm26996 A T 6: 130,579,354 noncoding transcript Het
Gm9386 C A 17: 80,938,712 noncoding transcript Het
Gpr6 A T 10: 41,071,262 M108K possibly damaging Het
H2-Q10 A C 17: 35,473,584 probably benign Het
Hpf1 A G 8: 60,893,807 D52G probably damaging Het
Jak2 A G 19: 29,301,977 R989G probably damaging Het
Kat7 A G 11: 95,303,123 probably benign Het
Kcnn3 G T 3: 89,662,724 V615F probably damaging Het
Lgi1 G T 19: 38,300,878 probably null Het
Lrrtm4 A T 6: 80,023,134 T510S possibly damaging Het
Map7d1 A G 4: 126,234,321 probably null Het
Mapt T C 11: 104,298,960 V252A probably benign Het
Mbd4 A T 6: 115,849,299 S223T possibly damaging Het
Meig1 T A 2: 3,411,922 I21L probably benign Het
Mia3 A G 1: 183,332,830 Y447H probably damaging Het
Mrpl46 A C 7: 78,780,595 N142K probably benign Het
Myo18a C A 11: 77,859,236 probably benign Het
Nup188 A G 2: 30,326,511 T776A possibly damaging Het
Oas1h C A 5: 120,862,665 H113N probably damaging Het
Olfr1505 A T 19: 13,919,453 L144F possibly damaging Het
Olfr771 T A 10: 129,160,376 T203S possibly damaging Het
Olfr830 A G 9: 18,875,917 I197V probably benign Het
Olfr845 C T 9: 19,339,180 T240M probably damaging Het
Orc3 T A 4: 34,572,450 probably benign Het
Osbpl3 T A 6: 50,353,000 L65F probably damaging Het
Papola C A 12: 105,799,653 P4Q probably damaging Het
Pepd A G 7: 34,945,597 N151S probably damaging Het
Prpf40a A T 2: 53,190,020 H82Q probably damaging Het
Robo1 C T 16: 72,972,035 T496M probably benign Het
Samd9l T G 6: 3,372,863 Q1466P probably damaging Het
Serpina1a T C 12: 103,854,763 T342A probably benign Het
Serpina3i A G 12: 104,265,211 T36A probably benign Het
Serpinb5 G T 1: 106,872,339 L86F probably damaging Het
Slc35g1 A G 19: 38,402,827 S186G possibly damaging Het
Slco6d1 T A 1: 98,423,174 D126E probably benign Het
Smchd1 A G 17: 71,411,768 probably null Het
Smpdl3a C A 10: 57,811,241 T355K probably damaging Het
Sntg2 A G 12: 30,373,268 probably benign Het
Sox14 T A 9: 99,875,231 M152L probably benign Het
Spats2l G T 1: 57,937,926 A308S possibly damaging Het
Tcf12 T C 9: 71,870,041 probably benign Het
Tcf7l2 T A 19: 55,924,072 C478* probably null Het
Tekt5 A G 16: 10,382,907 L250P probably damaging Het
Tmem132d T G 5: 127,984,264 I425L probably benign Het
Tmem174 T A 13: 98,636,948 I125F probably damaging Het
Trafd1 T G 5: 121,374,016 I404L probably benign Het
Trpm5 G A 7: 143,082,636 P500S possibly damaging Het
Trpm6 T A 19: 18,862,212 N1616K probably benign Het
Vmn1r4 A G 6: 56,956,730 D73G possibly damaging Het
Vmn2r85 T A 10: 130,418,698 I706F probably benign Het
Zc3h14 C G 12: 98,752,848 D157E probably damaging Het
Zfp982 A G 4: 147,512,633 Q149R possibly damaging Het
Other mutations in Plekhm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01060:Plekhm2 APN 4 141642645 splice site probably null
IGL01388:Plekhm2 APN 4 141642001 missense probably damaging 1.00
IGL01392:Plekhm2 APN 4 141642426 missense probably damaging 0.98
IGL01482:Plekhm2 APN 4 141630029 missense probably damaging 0.98
IGL01828:Plekhm2 APN 4 141629585 missense probably benign 0.11
IGL02010:Plekhm2 APN 4 141637419 splice site probably benign
IGL02075:Plekhm2 APN 4 141628306 missense probably benign 0.38
IGL02381:Plekhm2 APN 4 141642723 missense possibly damaging 0.95
IGL02543:Plekhm2 APN 4 141642019 missense probably benign 0.02
IGL02747:Plekhm2 APN 4 141634272 missense possibly damaging 0.55
IGL02802:Plekhm2 APN 4 141642524 splice site probably benign
IGL02828:Plekhm2 APN 4 141629630 missense probably damaging 1.00
IGL03286:Plekhm2 APN 4 141634347 missense possibly damaging 0.95
R0008:Plekhm2 UTSW 4 141642393 splice site probably benign
R0008:Plekhm2 UTSW 4 141642393 splice site probably benign
R0639:Plekhm2 UTSW 4 141642070 missense probably damaging 1.00
R0682:Plekhm2 UTSW 4 141628125 missense probably damaging 0.97
R0968:Plekhm2 UTSW 4 141629932 missense probably benign 0.01
R1109:Plekhm2 UTSW 4 141627984 missense probably benign 0.31
R1475:Plekhm2 UTSW 4 141627854 missense possibly damaging 0.75
R1802:Plekhm2 UTSW 4 141634347 missense probably benign 0.03
R1813:Plekhm2 UTSW 4 141642439 missense possibly damaging 0.93
R1844:Plekhm2 UTSW 4 141632374 missense probably benign
R2261:Plekhm2 UTSW 4 141642732 missense probably damaging 0.98
R3889:Plekhm2 UTSW 4 141641990 splice site probably benign
R3922:Plekhm2 UTSW 4 141629532 missense probably benign 0.01
R4324:Plekhm2 UTSW 4 141631857 missense possibly damaging 0.86
R4758:Plekhm2 UTSW 4 141642005 missense possibly damaging 0.91
R4983:Plekhm2 UTSW 4 141634376 missense probably damaging 1.00
R5468:Plekhm2 UTSW 4 141628100 missense probably damaging 1.00
R5691:Plekhm2 UTSW 4 141628289 missense possibly damaging 0.96
R5877:Plekhm2 UTSW 4 141639693 missense probably damaging 0.98
R6268:Plekhm2 UTSW 4 141632341 nonsense probably null
R6367:Plekhm2 UTSW 4 141639705 missense probably damaging 0.97
R6371:Plekhm2 UTSW 4 141629532 missense possibly damaging 0.94
R6489:Plekhm2 UTSW 4 141632033 missense probably damaging 1.00
R7266:Plekhm2 UTSW 4 141642459 missense possibly damaging 0.91
R7399:Plekhm2 UTSW 4 141634376 missense probably damaging 1.00
R7573:Plekhm2 UTSW 4 141631347 missense probably benign 0.02
R7742:Plekhm2 UTSW 4 141627839 missense probably benign 0.00
R7864:Plekhm2 UTSW 4 141628046 missense probably damaging 0.96
R7920:Plekhm2 UTSW 4 141632121 missense probably damaging 1.00
R8417:Plekhm2 UTSW 4 141627825 missense probably benign 0.04
R8504:Plekhm2 UTSW 4 141642453 missense probably damaging 1.00
T0722:Plekhm2 UTSW 4 141631981 small deletion probably benign
T0975:Plekhm2 UTSW 4 141631981 small deletion probably benign
X0024:Plekhm2 UTSW 4 141628041 missense probably damaging 1.00
Z1177:Plekhm2 UTSW 4 141629085 missense possibly damaging 0.77
Z1177:Plekhm2 UTSW 4 141639822 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- GGCCCAAAGTTTCTGACTATCTAAAG -3'
(R):5'- TTCACCTGCCACGAGGATTG -3'

Sequencing Primer
(F):5'- CTAAAGCTGTTGGCAAATTGCTGTC -3'
(R):5'- GAGGATTGCCAAACCAGCTTCTTTC -3'
Posted On2016-02-04