Incidental Mutation 'R4814:Oas1h'
ID 369629
Institutional Source Beutler Lab
Gene Symbol Oas1h
Ensembl Gene ENSMUSG00000001168
Gene Name 2'-5' oligoadenylate synthetase 1H
Synonyms
MMRRC Submission 042432-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.068) question?
Stock # R4814 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 120999485-121011569 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 121000728 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Asparagine at position 113 (H113N)
Ref Sequence ENSEMBL: ENSMUSP00000072297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057814] [ENSMUST00000072476] [ENSMUST00000171820]
AlphaFold Q8VI97
Predicted Effect probably benign
Transcript: ENSMUST00000057814
SMART Domains Protein: ENSMUSP00000056993
Gene: ENSMUSG00000053765

DomainStartEndE-ValueType
Pfam:OAS1_C 169 353 4.6e-81 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000072476
AA Change: H113N

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000072297
Gene: ENSMUSG00000001168
AA Change: H113N

DomainStartEndE-ValueType
Pfam:NTP_transf_2 45 146 1.6e-9 PFAM
Pfam:OAS1_C 175 361 2.3e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123431
Predicted Effect probably damaging
Transcript: ENSMUST00000171820
AA Change: H113N

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000132033
Gene: ENSMUSG00000001168
AA Change: H113N

DomainStartEndE-ValueType
Pfam:NTP_transf_2 46 157 1.6e-7 PFAM
Pfam:OAS1_C 174 236 1e-22 PFAM
Meta Mutation Damage Score 0.1875 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 100% (79/79)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp T G 16: 56,471,116 (GRCm39) V587G probably benign Het
Abtb2 A G 2: 103,547,632 (GRCm39) D1002G probably benign Het
Acap2 A G 16: 30,926,944 (GRCm39) S524P probably benign Het
Acsm1 A T 7: 119,254,687 (GRCm39) I385L probably benign Het
Adra1a C G 14: 66,875,481 (GRCm39) A152G probably benign Het
Agbl4 A T 4: 111,513,565 (GRCm39) Y437F possibly damaging Het
Amt A G 9: 108,176,979 (GRCm39) T196A probably benign Het
Apobr G A 7: 126,185,859 (GRCm39) V457M probably benign Het
Birc6 A G 17: 74,956,667 (GRCm39) K3563E probably damaging Het
Cdadc1 AGACGGA AGA 14: 59,806,440 (GRCm39) probably null Het
Chrna9 T C 5: 66,134,492 (GRCm39) W448R probably damaging Het
Cyp4a31 A T 4: 115,427,466 (GRCm39) D224V probably damaging Het
Ddx10 C A 9: 53,115,405 (GRCm39) R643L possibly damaging Het
Dip2c A G 13: 9,586,896 (GRCm39) H200R probably benign Het
Dnah8 A T 17: 30,986,898 (GRCm39) R3182S probably damaging Het
Dnase1l1 C T X: 73,320,644 (GRCm39) probably null Het
Egfr T C 11: 16,819,354 (GRCm39) C295R probably damaging Het
Garem1 A T 18: 21,281,173 (GRCm39) N394K probably damaging Het
Gcat T C 15: 78,915,322 (GRCm39) probably null Het
Gckr C T 5: 31,455,644 (GRCm39) Q66* probably null Het
Gm26996 A T 6: 130,556,317 (GRCm39) noncoding transcript Het
Gm9386 C A 17: 81,246,141 (GRCm39) noncoding transcript Het
Gpr6 A T 10: 40,947,258 (GRCm39) M108K possibly damaging Het
H2-Q10 A C 17: 35,784,481 (GRCm39) probably benign Het
Hpf1 A G 8: 61,346,841 (GRCm39) D52G probably damaging Het
Jak2 A G 19: 29,279,377 (GRCm39) R989G probably damaging Het
Kat7 A G 11: 95,193,949 (GRCm39) probably benign Het
Kcnn3 G T 3: 89,570,031 (GRCm39) V615F probably damaging Het
Lgi1 G T 19: 38,289,326 (GRCm39) probably null Het
Lrrtm4 A T 6: 80,000,117 (GRCm39) T510S possibly damaging Het
Map7d1 A G 4: 126,128,114 (GRCm39) probably null Het
Mapt T C 11: 104,189,786 (GRCm39) V252A probably benign Het
Mbd4 A T 6: 115,826,260 (GRCm39) S223T possibly damaging Het
Meig1 T A 2: 3,412,959 (GRCm39) I21L probably benign Het
Mia3 A G 1: 183,113,684 (GRCm39) Y447H probably damaging Het
Mrpl46 A C 7: 78,430,343 (GRCm39) N142K probably benign Het
Myo18a C A 11: 77,750,062 (GRCm39) probably benign Het
Nup188 A G 2: 30,216,523 (GRCm39) T776A possibly damaging Het
Or6c202 T A 10: 128,996,245 (GRCm39) T203S possibly damaging Het
Or7g18 A G 9: 18,787,213 (GRCm39) I197V probably benign Het
Or7g27 C T 9: 19,250,476 (GRCm39) T240M probably damaging Het
Or9i1b A T 19: 13,896,817 (GRCm39) L144F possibly damaging Het
Orc3 T A 4: 34,572,450 (GRCm39) probably benign Het
Osbpl3 T A 6: 50,329,980 (GRCm39) L65F probably damaging Het
Papola C A 12: 105,765,912 (GRCm39) P4Q probably damaging Het
Pepd A G 7: 34,645,022 (GRCm39) N151S probably damaging Het
Plekhm2 A G 4: 141,355,150 (GRCm39) L959P probably benign Het
Prpf40a A T 2: 53,080,032 (GRCm39) H82Q probably damaging Het
Robo1 C T 16: 72,768,923 (GRCm39) T496M probably benign Het
Samd9l T G 6: 3,372,863 (GRCm39) Q1466P probably damaging Het
Serpina1a T C 12: 103,821,022 (GRCm39) T342A probably benign Het
Serpina3i A G 12: 104,231,470 (GRCm39) T36A probably benign Het
Serpinb5 G T 1: 106,800,069 (GRCm39) L86F probably damaging Het
Slc35g1 A G 19: 38,391,275 (GRCm39) S186G possibly damaging Het
Slco6d1 T A 1: 98,350,899 (GRCm39) D126E probably benign Het
Smchd1 A G 17: 71,718,763 (GRCm39) probably null Het
Smpdl3a C A 10: 57,687,337 (GRCm39) T355K probably damaging Het
Sntg2 A G 12: 30,423,267 (GRCm39) probably benign Het
Sox14 T A 9: 99,757,284 (GRCm39) M152L probably benign Het
Spats2l G T 1: 57,977,085 (GRCm39) A308S possibly damaging Het
Tcf12 T C 9: 71,777,323 (GRCm39) probably benign Het
Tcf7l2 T A 19: 55,912,504 (GRCm39) C478* probably null Het
Tekt5 A G 16: 10,200,771 (GRCm39) L250P probably damaging Het
Tmem132d T G 5: 128,061,328 (GRCm39) I425L probably benign Het
Tmem174 T A 13: 98,773,456 (GRCm39) I125F probably damaging Het
Trafd1 T G 5: 121,512,079 (GRCm39) I404L probably benign Het
Trpm5 G A 7: 142,636,373 (GRCm39) P500S possibly damaging Het
Trpm6 T A 19: 18,839,576 (GRCm39) N1616K probably benign Het
Vmn1r4 A G 6: 56,933,715 (GRCm39) D73G possibly damaging Het
Vmn2r85 T A 10: 130,254,567 (GRCm39) I706F probably benign Het
Zc3h14 C G 12: 98,719,107 (GRCm39) D157E probably damaging Het
Zfp982 A G 4: 147,597,090 (GRCm39) Q149R possibly damaging Het
Other mutations in Oas1h
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01676:Oas1h APN 5 121,009,897 (GRCm39) missense probably damaging 1.00
IGL01890:Oas1h APN 5 121,000,852 (GRCm39) splice site probably null
IGL02745:Oas1h APN 5 120,999,542 (GRCm39) missense probably benign 0.04
IGL02888:Oas1h APN 5 120,999,610 (GRCm39) missense probably benign 0.34
IGL02970:Oas1h APN 5 120,999,698 (GRCm39) missense possibly damaging 0.91
R0125:Oas1h UTSW 5 121,000,626 (GRCm39) nonsense probably null
R1261:Oas1h UTSW 5 121,009,930 (GRCm39) missense probably benign 0.01
R1506:Oas1h UTSW 5 121,009,951 (GRCm39) missense possibly damaging 0.66
R1565:Oas1h UTSW 5 121,000,663 (GRCm39) missense probably damaging 0.97
R1696:Oas1h UTSW 5 121,000,885 (GRCm39) critical splice donor site probably null
R1750:Oas1h UTSW 5 121,009,840 (GRCm39) splice site probably null
R3116:Oas1h UTSW 5 120,999,679 (GRCm39) nonsense probably null
R4906:Oas1h UTSW 5 121,005,172 (GRCm39) nonsense probably null
R4944:Oas1h UTSW 5 121,000,846 (GRCm39) missense probably damaging 1.00
R4961:Oas1h UTSW 5 121,009,159 (GRCm39) missense probably damaging 1.00
R5160:Oas1h UTSW 5 121,009,145 (GRCm39) missense probably damaging 1.00
R5698:Oas1h UTSW 5 121,009,045 (GRCm39) missense probably damaging 1.00
R5903:Oas1h UTSW 5 121,009,040 (GRCm39) missense probably damaging 1.00
R6014:Oas1h UTSW 5 121,005,229 (GRCm39) missense possibly damaging 0.68
R7062:Oas1h UTSW 5 120,999,528 (GRCm39) unclassified probably benign
R7966:Oas1h UTSW 5 121,009,962 (GRCm39) missense probably damaging 0.97
R7975:Oas1h UTSW 5 121,009,890 (GRCm39) missense probably damaging 1.00
R8777:Oas1h UTSW 5 121,005,107 (GRCm39) missense probably damaging 1.00
R8777-TAIL:Oas1h UTSW 5 121,005,107 (GRCm39) missense probably damaging 1.00
R8951:Oas1h UTSW 5 121,000,657 (GRCm39) missense probably damaging 1.00
R8987:Oas1h UTSW 5 121,005,152 (GRCm39) missense probably damaging 1.00
R9748:Oas1h UTSW 5 121,005,088 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGAGCTTTCTCCATCCAAGAATC -3'
(R):5'- TGCTGACTTACACAGGGCATC -3'

Sequencing Primer
(F):5'- GACTGACCAGCATGGCTCTTC -3'
(R):5'- TTACACAGGGCATCATAGGCTGTC -3'
Posted On 2016-02-04