Incidental Mutation 'R4814:Pepd'
ID369638
Institutional Source Beutler Lab
Gene Symbol Pepd
Ensembl Gene ENSMUSG00000063931
Gene Namepeptidase D
SynonymsPep4, Pep-4, dal, peptidase D
MMRRC Submission 042432-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4814 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location34912379-35044708 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34945597 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 151 (N151S)
Ref Sequence ENSEMBL: ENSMUSP00000075683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075068]
Predicted Effect probably damaging
Transcript: ENSMUST00000075068
AA Change: N151S

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000075683
Gene: ENSMUSG00000063931
AA Change: N151S

DomainStartEndE-ValueType
AMP_N 18 155 2.71e-39 SMART
Pfam:Peptidase_M24 193 459 5.4e-61 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104281
Predicted Effect unknown
Transcript: ENSMUST00000161900
AA Change: N3S
SMART Domains Protein: ENSMUSP00000133634
Gene: ENSMUSG00000063931
AA Change: N3S

DomainStartEndE-ValueType
Blast:AMP_N 2 35 3e-15 BLAST
PDB:2OKN|B 2 76 1e-43 PDB
SCOP:d1b6a_2 7 77 2e-12 SMART
Meta Mutation Damage Score 0.1956 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase family. The protein forms a homodimer that hydrolyzes dipeptides or tripeptides with C-terminal proline or hydroxyproline residues. The enzyme serves an important role in the recycling of proline, and may be rate limiting for the production of collagen. Mutations in this gene result in prolidase deficiency, which is characterized by the excretion of large amount of di- and tri-peptides containing proline. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutants are smaller than normal siblings and, except on the flanks, an agouti coat appears nonagouti. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp T G 16: 56,650,753 V587G probably benign Het
Abtb2 A G 2: 103,717,287 D1002G probably benign Het
Acap2 A G 16: 31,108,126 S524P probably benign Het
Acsm1 A T 7: 119,655,464 I385L probably benign Het
Adra1a C G 14: 66,638,032 A152G probably benign Het
Agbl4 A T 4: 111,656,368 Y437F possibly damaging Het
Amt A G 9: 108,299,780 T196A probably benign Het
Apobr G A 7: 126,586,687 V457M probably benign Het
Birc6 A G 17: 74,649,672 K3563E probably damaging Het
Cdadc1 AGACGGA AGA 14: 59,568,991 probably null Het
Chrna9 T C 5: 65,977,149 W448R probably damaging Het
Cyp4a31 A T 4: 115,570,269 D224V probably damaging Het
Ddx10 C A 9: 53,204,105 R643L possibly damaging Het
Dip2c A G 13: 9,536,860 H200R probably benign Het
Dnah8 A T 17: 30,767,924 R3182S probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Egfr T C 11: 16,869,354 C295R probably damaging Het
Garem1 A T 18: 21,148,116 N394K probably damaging Het
Gcat T C 15: 79,031,122 probably null Het
Gckr C T 5: 31,298,300 Q66* probably null Het
Gm26996 A T 6: 130,579,354 noncoding transcript Het
Gm9386 C A 17: 80,938,712 noncoding transcript Het
Gpr6 A T 10: 41,071,262 M108K possibly damaging Het
H2-Q10 A C 17: 35,473,584 probably benign Het
Hpf1 A G 8: 60,893,807 D52G probably damaging Het
Jak2 A G 19: 29,301,977 R989G probably damaging Het
Kat7 A G 11: 95,303,123 probably benign Het
Kcnn3 G T 3: 89,662,724 V615F probably damaging Het
Lgi1 G T 19: 38,300,878 probably null Het
Lrrtm4 A T 6: 80,023,134 T510S possibly damaging Het
Map7d1 A G 4: 126,234,321 probably null Het
Mapt T C 11: 104,298,960 V252A probably benign Het
Mbd4 A T 6: 115,849,299 S223T possibly damaging Het
Meig1 T A 2: 3,411,922 I21L probably benign Het
Mia3 A G 1: 183,332,830 Y447H probably damaging Het
Mrpl46 A C 7: 78,780,595 N142K probably benign Het
Myo18a C A 11: 77,859,236 probably benign Het
Nup188 A G 2: 30,326,511 T776A possibly damaging Het
Oas1h C A 5: 120,862,665 H113N probably damaging Het
Olfr1505 A T 19: 13,919,453 L144F possibly damaging Het
Olfr771 T A 10: 129,160,376 T203S possibly damaging Het
Olfr830 A G 9: 18,875,917 I197V probably benign Het
Olfr845 C T 9: 19,339,180 T240M probably damaging Het
Orc3 T A 4: 34,572,450 probably benign Het
Osbpl3 T A 6: 50,353,000 L65F probably damaging Het
Papola C A 12: 105,799,653 P4Q probably damaging Het
Plekhm2 A G 4: 141,627,839 L959P probably benign Het
Prpf40a A T 2: 53,190,020 H82Q probably damaging Het
Robo1 C T 16: 72,972,035 T496M probably benign Het
Samd9l T G 6: 3,372,863 Q1466P probably damaging Het
Serpina1a T C 12: 103,854,763 T342A probably benign Het
Serpina3i A G 12: 104,265,211 T36A probably benign Het
Serpinb5 G T 1: 106,872,339 L86F probably damaging Het
Slc35g1 A G 19: 38,402,827 S186G possibly damaging Het
Slco6d1 T A 1: 98,423,174 D126E probably benign Het
Smchd1 A G 17: 71,411,768 probably null Het
Smpdl3a C A 10: 57,811,241 T355K probably damaging Het
Sntg2 A G 12: 30,373,268 probably benign Het
Sox14 T A 9: 99,875,231 M152L probably benign Het
Spats2l G T 1: 57,937,926 A308S possibly damaging Het
Tcf12 T C 9: 71,870,041 probably benign Het
Tcf7l2 T A 19: 55,924,072 C478* probably null Het
Tekt5 A G 16: 10,382,907 L250P probably damaging Het
Tmem132d T G 5: 127,984,264 I425L probably benign Het
Tmem174 T A 13: 98,636,948 I125F probably damaging Het
Trafd1 T G 5: 121,374,016 I404L probably benign Het
Trpm5 G A 7: 143,082,636 P500S possibly damaging Het
Trpm6 T A 19: 18,862,212 N1616K probably benign Het
Vmn1r4 A G 6: 56,956,730 D73G possibly damaging Het
Vmn2r85 T A 10: 130,418,698 I706F probably benign Het
Zc3h14 C G 12: 98,752,848 D157E probably damaging Het
Zfp982 A G 4: 147,512,633 Q149R possibly damaging Het
Other mutations in Pepd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01522:Pepd APN 7 34924440 missense probably benign
IGL02102:Pepd APN 7 34945603 missense probably damaging 1.00
R1256:Pepd UTSW 7 34921492 missense possibly damaging 0.95
R1690:Pepd UTSW 7 35031357 missense probably damaging 1.00
R1734:Pepd UTSW 7 35031426 missense probably benign 0.07
R1911:Pepd UTSW 7 34934749 splice site probably benign
R1918:Pepd UTSW 7 34971676 missense probably benign 0.00
R2144:Pepd UTSW 7 34921418 missense probably benign 0.09
R4924:Pepd UTSW 7 35020984 missense probably benign 0.24
R5490:Pepd UTSW 7 34942690 splice site probably null
R5669:Pepd UTSW 7 35040674 missense probably benign 0.38
R6240:Pepd UTSW 7 35021751 missense probably benign 0.00
R6300:Pepd UTSW 7 34969543 missense probably damaging 1.00
R6479:Pepd UTSW 7 35040722 missense probably benign 0.00
R6995:Pepd UTSW 7 35021719 missense probably damaging 1.00
R7303:Pepd UTSW 7 35021772 critical splice donor site probably null
R7587:Pepd UTSW 7 34969540 missense probably damaging 1.00
R8008:Pepd UTSW 7 35021701 missense probably benign 0.22
R8672:Pepd UTSW 7 34942682 missense probably damaging 0.97
R8815:Pepd UTSW 7 34971691 missense probably damaging 1.00
X0021:Pepd UTSW 7 34954563 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGCTTTTCACATTGCACTAGG -3'
(R):5'- ACATCGTTCCTTCAAACACTTGATC -3'

Sequencing Primer
(F):5'- AAAAAGCCTGTCTTTGTTCTGG -3'
(R):5'- GTTCCTTCAAACACTTGATCCAACC -3'
Posted On2016-02-04