Incidental Mutation 'R0420:Arnt'
ID36968
Institutional Source Beutler Lab
Gene Symbol Arnt
Ensembl Gene ENSMUSG00000015522
Gene Namearyl hydrocarbon receptor nuclear translocator
SynonymsESTM42, Hif1b, D3Ertd557e, bHLHe2
MMRRC Submission 038622-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0420 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location95434388-95497240 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 95470394 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000102779 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015666] [ENSMUST00000090804] [ENSMUST00000102749] [ENSMUST00000107161]
Predicted Effect probably benign
Transcript: ENSMUST00000015666
SMART Domains Protein: ENSMUSP00000015666
Gene: ENSMUSG00000015522

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
HLH 69 128 2.9e-11 SMART
PAS 143 210 7.4e-13 SMART
low complexity region 231 242 N/A INTRINSIC
PAS 332 397 7.6e-10 SMART
PAC 404 447 9.6e-7 SMART
low complexity region 705 718 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090804
SMART Domains Protein: ENSMUSP00000088313
Gene: ENSMUSG00000015522

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
HLH 80 133 1e-14 SMART
PAS 148 215 1.51e-10 SMART
low complexity region 236 247 N/A INTRINSIC
PAS 337 402 1.55e-7 SMART
PAC 409 452 1.95e-4 SMART
low complexity region 710 723 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102749
SMART Domains Protein: ENSMUSP00000099810
Gene: ENSMUSG00000015522

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
HLH 95 148 1e-14 SMART
PAS 163 230 1.51e-10 SMART
low complexity region 251 262 N/A INTRINSIC
PAS 352 417 1.55e-7 SMART
PAC 424 467 1.95e-4 SMART
low complexity region 725 738 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107161
SMART Domains Protein: ENSMUSP00000102779
Gene: ENSMUSG00000015522

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
HLH 80 133 1e-14 SMART
PAS 148 215 1.51e-10 SMART
low complexity region 236 247 N/A INTRINSIC
PAS 337 402 1.55e-7 SMART
PAC 409 452 1.95e-4 SMART
low complexity region 694 707 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140060
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147765
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149051
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156653
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.2%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a basic helix-loop-helix domain and two characteristic PAS domains along with a PAC domain. The encoded protein binds to ligand-bound aryl hydrocarbon receptor and aids in the movement of this complex to the nucleus, where it promotes the expression of genes involved in xenobiotic metabolism. This protein is also a co-factor for transcriptional regulation by hypoxia-inducible factor 1. Chromosomal translocation of this locus with the ETV6 (ets variant 6) gene on chromosome 12 have been described in leukemias. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2013]
PHENOTYPE: Homozygotes for targeted null mutations exhibit loss of aryl hydrocarbon receptor and hypoxia-inducible factor 1 alpha gene induction, defective angiogenesis of the yolk sac and branchial arches, placental defects, and lethality by embryonic day 10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415O20Rik A G 15: 98,571,094 S17G probably benign Het
Abcb4 T C 5: 8,941,050 V870A probably benign Het
Adam6b A T 12: 113,489,994 M144L probably benign Het
Adrb2 T A 18: 62,179,539 I72L possibly damaging Het
Ankrd53 A T 6: 83,763,692 H99L probably damaging Het
Ap4e1 C T 2: 127,049,360 T17M probably damaging Het
Atp1a3 C T 7: 24,980,627 G884E probably benign Het
Atp6v1b1 T C 6: 83,752,844 probably benign Het
Atp8a2 G T 14: 59,773,744 T971K probably damaging Het
BC048562 A T 9: 108,445,966 T167S probably benign Het
Brd9 A G 13: 73,955,473 M491V probably benign Het
Btnl10 A T 11: 58,923,451 D319V probably damaging Het
Cadps T A 14: 12,491,800 R783S probably damaging Het
Ccdc149 A G 5: 52,400,239 probably benign Het
Ccm2l A T 2: 153,070,862 D107V probably null Het
Cep192 A G 18: 67,813,893 E213G possibly damaging Het
Cyp2c37 A C 19: 39,995,794 N242T probably benign Het
Dnah17 A G 11: 118,039,939 V3750A probably damaging Het
Ehbp1 T A 11: 22,151,836 I231L probably benign Het
Emilin3 A G 2: 160,910,879 probably benign Het
Eya4 T C 10: 23,155,963 N254S possibly damaging Het
Fam184b A G 5: 45,584,512 S126P probably damaging Het
Fancd2 T C 6: 113,536,979 L108P probably damaging Het
Fgf12 A T 16: 28,162,529 M145K possibly damaging Het
Gabbr1 A G 17: 37,046,762 N23S possibly damaging Het
Ggt1 T A 10: 75,576,213 probably benign Het
Gm1966 T A 7: 106,603,883 L51F probably damaging Het
Gm6434 T A 7: 25,882,361 noncoding transcript Het
Gm6614 T G 6: 141,985,477 probably benign Het
Grik4 A T 9: 42,622,096 L376* probably null Het
Gzf1 A G 2: 148,683,833 T75A probably benign Het
Hcn1 T C 13: 117,975,375 I625T unknown Het
Hhat C T 1: 192,552,934 probably null Het
Ifit1bl1 T C 19: 34,594,514 E181G probably damaging Het
Kif21a T C 15: 90,968,054 probably benign Het
Lrrc45 A C 11: 120,715,219 S118R probably damaging Het
Mcm9 T C 10: 53,548,527 I656V probably benign Het
Ms4a5 A G 19: 11,283,654 L47S probably damaging Het
Mynn A T 3: 30,607,459 N230I probably benign Het
Nck2 T C 1: 43,554,118 S162P probably damaging Het
Nfat5 T C 8: 107,367,461 F259S probably damaging Het
Obox1 T G 7: 15,556,253 S174A possibly damaging Het
Ociad1 T A 5: 73,313,429 probably null Het
Pgbd1 A T 13: 21,423,166 V286E possibly damaging Het
Phlpp2 T C 8: 109,939,935 V1032A probably damaging Het
Ppm1e C T 11: 87,240,614 A318T probably damaging Het
Prex1 T A 2: 166,589,571 D757V probably benign Het
Ptpdc1 C A 13: 48,589,119 probably null Het
Rbbp5 T G 1: 132,493,844 I94R possibly damaging Het
Rnpc3 A G 3: 113,621,869 V173A probably benign Het
Sgsm1 A T 5: 113,263,759 N700K probably benign Het
Sox14 T A 9: 99,875,122 H188L probably damaging Het
Supt5 T A 7: 28,317,329 probably benign Het
Synpo A G 18: 60,602,418 S819P probably damaging Het
Tenm2 A G 11: 36,207,124 probably benign Het
Tenm4 T C 7: 96,873,766 V1468A possibly damaging Het
Tiam2 A G 17: 3,502,918 N83S probably benign Het
Tle6 T C 10: 81,595,311 probably benign Het
Tm2d2 T G 8: 25,018,114 N91K probably damaging Het
Tmem132d T G 5: 127,864,646 Q463H probably benign Het
Tmf1 A G 6: 97,176,141 S324P probably damaging Het
Tnc T C 4: 64,000,159 T1172A probably benign Het
Usp17lb A T 7: 104,840,539 C393S probably benign Het
Usp42 G A 5: 143,714,861 L1136F probably damaging Het
Vmn2r92 T G 17: 18,168,921 M499R probably benign Het
Vps54 T A 11: 21,311,071 probably benign Het
Wdr6 C T 9: 108,573,101 R1076H probably benign Het
Wdr72 T A 9: 74,210,757 M917K possibly damaging Het
Wee2 T C 6: 40,456,995 V281A probably benign Het
Zc3h6 A G 2: 129,014,827 D609G probably benign Het
Zfp345 G A 2: 150,473,243 H125Y possibly damaging Het
Zhx2 A G 15: 57,821,840 K202E probably damaging Het
Zic2 CCCACCACCACCATCACCACCACCACC CCCACCATCACCACCACCACC 14: 122,476,364 probably benign Het
Other mutations in Arnt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Arnt APN 3 95490340 missense probably damaging 0.98
IGL00949:Arnt APN 3 95487268 missense probably damaging 1.00
IGL01304:Arnt APN 3 95448385 missense probably damaging 1.00
IGL01634:Arnt APN 3 95470398 splice site probably benign
IGL01685:Arnt APN 3 95474681 missense probably damaging 1.00
IGL01768:Arnt APN 3 95491016 unclassified probably benign
IGL02738:Arnt APN 3 95495320 unclassified probably null
IGL02941:Arnt APN 3 95460370 splice site probably benign
R0211:Arnt UTSW 3 95476149 missense probably damaging 1.00
R0211:Arnt UTSW 3 95476149 missense probably damaging 1.00
R0801:Arnt UTSW 3 95493846 missense possibly damaging 0.86
R1418:Arnt UTSW 3 95470399 splice site probably benign
R1523:Arnt UTSW 3 95489654 missense possibly damaging 0.77
R1956:Arnt UTSW 3 95448393 missense possibly damaging 0.94
R1957:Arnt UTSW 3 95448393 missense possibly damaging 0.94
R1958:Arnt UTSW 3 95448393 missense possibly damaging 0.94
R1969:Arnt UTSW 3 95448393 missense possibly damaging 0.94
R1970:Arnt UTSW 3 95448393 missense possibly damaging 0.94
R1971:Arnt UTSW 3 95448393 missense possibly damaging 0.94
R3743:Arnt UTSW 3 95474705 missense possibly damaging 0.49
R4561:Arnt UTSW 3 95452613 missense probably damaging 0.96
R4780:Arnt UTSW 3 95488385 missense probably damaging 1.00
R4827:Arnt UTSW 3 95489913 unclassified probably null
R4913:Arnt UTSW 3 95490654 missense probably damaging 1.00
R5051:Arnt UTSW 3 95470337 missense probably benign 0.08
R5572:Arnt UTSW 3 95474704 missense possibly damaging 0.49
R5866:Arnt UTSW 3 95490726 unclassified probably benign
R6376:Arnt UTSW 3 95490625 missense probably damaging 0.99
R6491:Arnt UTSW 3 95476143 missense probably damaging 1.00
R6873:Arnt UTSW 3 95474575 missense probably damaging 1.00
R6920:Arnt UTSW 3 95490621 missense probably damaging 0.99
R7485:Arnt UTSW 3 95495348 missense probably damaging 1.00
R7731:Arnt UTSW 3 95483775 missense probably benign 0.33
R7786:Arnt UTSW 3 95484956 missense probably damaging 0.96
R7797:Arnt UTSW 3 95480261 critical splice donor site probably null
X0020:Arnt UTSW 3 95494565 missense probably benign 0.10
X0026:Arnt UTSW 3 95474630 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGACGGAACAAGATGACAGCTTAC -3'
(R):5'- ACTGATCCATGAGTGTGGCAACC -3'

Sequencing Primer
(F):5'- GCTTACATCACAGAACTGTCAG -3'
(R):5'- CACAGGTCATTTGTATGAGCC -3'
Posted On2013-05-09