Mutagenetix > Incidental Mutation

Incidental Mutation 'R4815:Slc9a2'

369686

Institutional Source

Beutler Lab

Gene Symbol

Slc9a2

Ensembl Gene

ENSMUSG00000026062

Gene Name

solute carrier family 9 (sodium/hydrogen exchanger), member 2

Synonyms

2210416H12Rik, 4932415O19Rik, NHE2

MMRRC Submission

042433-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.058) question?

Stock #

R4815 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

40680574-40769273 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 40718849 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 183 (I183F)

Ref Sequence

ENSEMBL: ENSMUSP00000142144 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027231] [ENSMUST00000192345]

AlphaFold

Q3ZAS0

Predicted Effect

probably benign
Transcript: ENSMUST00000027231
AA Change: I183F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000027231
Gene: ENSMUSG00000026062
AA Change: I183F

Domain	Start	End	E-Value	Type
signal peptide	1	34	N/A	INTRINSIC
low complexity region	40	60	N/A	INTRINSIC
Pfam:Na_H_Exchanger	85	486	1.4e-95	PFAM
low complexity region	528	543	N/A	INTRINSIC
Pfam:NEXCaM_BD	576	685	3e-44	PFAM
low complexity region	738	753	N/A	INTRINSIC
low complexity region	788	793	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000192345
AA Change: I183F

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000142144
Gene: ENSMUSG00000026062
AA Change: I183F

Domain	Start	End	E-Value	Type
signal peptide	1	34	N/A	INTRINSIC
low complexity region	40	60	N/A	INTRINSIC
Pfam:Na_H_Exchanger	85	336	2.5e-56	PFAM

Meta Mutation Damage Score

0.1768

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.5%

Validation Efficiency

96% (76/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium-hydrogen exchanger (NHE) protein family. These proteins are involved in sodium-ion transport by exchanging intracellular hydrogen ions to external sodium ions and help in the regulation of cell pH and volume. The encoded protein is localized to the apical membrane and is involved in apical absorption of sodium. [provided by RefSeq, Jun 2016]
PHENOTYPE: Gastric acid secretion is impaired in homozygous mutant mice. The gastric mucosa becomes inflamed and exhibits an altered cellular composition. Mutant mice do not breed well. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alpk2	A	T	18: 65,349,955	N327K	probably damaging	Het
Ank2	T	C	3: 126,936,761	T675A	probably benign	Het
Arap3	T	C	18: 37,973,243	T1516A	probably benign	Het
Asb18	A	T	1: 90,014,425	N51K	probably damaging	Het
BC003331	A	G	1: 150,374,846	C294R	probably damaging	Het
C7	A	G	15: 5,059,405	V18A	probably benign	Het
Caap1	A	G	4: 94,501,260	V279A	probably benign	Het
Cacnb2	A	G	2: 14,874,780	D21G	probably damaging	Het
Ccdc171	T	C	4: 83,795,221	S1166P	probably damaging	Het
Chgb	A	T	2: 132,793,299	H387L	probably benign	Het
Chp2	G	A	7: 122,220,900	R91Q	probably damaging	Het
Chuk	C	A	19: 44,077,247	G703*	probably null	Het
Clmn	T	C	12: 104,785,566	D210G	probably damaging	Het
Cyp4f18	A	G	8: 71,995,995	V270A	possibly damaging	Het
Dgcr2	A	G	16: 17,858,619		probably benign	Het
Diaph1	A	T	18: 37,895,203	V411D	unknown	Het
Dkk2	C	T	3: 132,173,785	A75V	probably benign	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Dnase2a	T	C	8: 84,909,877	V187A	probably benign	Het
Dusp19	A	G	2: 80,630,945	M193V	probably benign	Het
Ear-ps2	G	A	14: 44,047,060		noncoding transcript	Het
Gm37596	C	T	3: 93,692,286	V259M	probably benign	Het
Golgb1	A	T	16: 36,913,115	Q908L	possibly damaging	Het
Hsp90aa1	T	C	12: 110,695,226	M119V	possibly damaging	Het
Ice2	C	T	9: 69,407,118	R50C	probably damaging	Het
Ifi208	A	T	1: 173,682,837	E186V	probably damaging	Het
Ift122	A	G	6: 115,881,556	K166E	possibly damaging	Het
Jcad	T	A	18: 4,675,223	L995Q	possibly damaging	Het
Kcnc4	A	T	3: 107,458,266	C209S	probably benign	Het
Kmt2a	G	A	9: 44,821,256		probably benign	Het
Lrriq1	T	A	10: 103,144,878	L1465F	probably benign	Het
Map3k7	C	A	4: 31,988,592	T247N	probably damaging	Het
Mctp2	T	G	7: 72,259,349	Q72P	possibly damaging	Het
Miga1	T	C	3: 152,290,806	Y335C	probably benign	Het
Ms4a14	A	T	19: 11,314,277	N19K	probably benign	Het
Mylk	G	A	16: 34,894,925	R541Q	probably damaging	Het
Nav3	T	C	10: 109,823,552	T735A	probably benign	Het
Nlgn1	T	A	3: 25,436,030	H511L	probably damaging	Het
Nlrp4a	A	T	7: 26,450,808	E613D	probably benign	Het
Nuf2	A	G	1: 169,510,468	S247P	probably damaging	Het
Ocstamp	A	G	2: 165,398,182	V28A	probably benign	Het
Odf2	A	C	2: 29,902,240	E155D	possibly damaging	Het
Olfr285	T	C	15: 98,312,680	N290S	probably damaging	Het
Olfr695	G	A	7: 106,874,237	P3S	probably benign	Het
Otud7a	T	C	7: 63,729,910		probably null	Het
Pacsin2	A	T	15: 83,385,059	D11E	probably damaging	Het
Pcdhga5	G	A	18: 37,695,194	V232I	probably damaging	Het
Plcb3	A	G	19: 6,962,984	I439T	possibly damaging	Het
Rag1	A	G	2: 101,643,516	V427A	probably damaging	Het
Ranbp10	A	T	8: 105,826,125	C128*	probably null	Het
Rbm8a2	A	G	1: 175,978,458	V151A	probably damaging	Het
S100pbp	A	G	4: 129,150,933		probably benign	Het
Serpinb5	G	T	1: 106,872,339	L86F	probably damaging	Het
Sgo2b	T	C	8: 63,931,414	I183V	probably benign	Het
Slc25a25	A	T	2: 32,420,410	D112E	probably damaging	Het
Slc30a5	C	T	13: 100,813,710	V103I	probably damaging	Het
Srrm4	T	A	5: 116,475,190	K141N	unknown	Het
Tbc1d20	T	C	2: 152,311,989		probably benign	Het
Tep1	A	G	14: 50,841,302	L1498P	probably damaging	Het
Tgfbi	T	C	13: 56,632,120	M494T	probably benign	Het
Tox	A	G	4: 6,823,033	S95P	probably benign	Het
Tpr	G	A	1: 150,398,608	V163I	probably benign	Het
Trpm7	A	G	2: 126,858,492	S2P	probably damaging	Het
Ttn	A	G	2: 76,716,085	M32328T	probably damaging	Het
Vps39	A	T	2: 120,338,559	N289K	probably benign	Het
Xdh	C	T	17: 73,906,215	A847T	probably damaging	Het
Xndc1	G	A	7: 102,073,316	G63R	probably null	Het
Ythdc2	A	G	18: 44,885,240	S1330G	probably benign	Het
Zc3h14	C	G	12: 98,752,848	D157E	probably damaging	Het
Zc3h7b	A	T	15: 81,793,663	K949N	probably damaging	Het
Zp3r	A	T	1: 130,598,912	Y185N	probably damaging	Het

Other mutations in Slc9a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Slc9a2	APN	1	40767737	missense	probably benign
IGL00487:Slc9a2	APN	1	40742658	missense	probably damaging	0.99
IGL00500:Slc9a2	APN	1	40763583	missense	possibly damaging	0.95
IGL01445:Slc9a2	APN	1	40718810	missense	possibly damaging	0.51
IGL02060:Slc9a2	APN	1	40756293	missense	probably damaging	0.99
IGL02813:Slc9a2	APN	1	40742669	missense	probably damaging	1.00
IGL02894:Slc9a2	APN	1	40763602	missense	probably benign	0.20
IGL02939:Slc9a2	APN	1	40742703	missense	probably damaging	1.00
IGL03193:Slc9a2	APN	1	40756271	missense	probably benign	0.00
putty	UTSW	1	40742653	nonsense	probably null
E0370:Slc9a2	UTSW	1	40763541	critical splice acceptor site	probably null
PIT4377001:Slc9a2	UTSW	1	40743841	missense	probably damaging	1.00
R0009:Slc9a2	UTSW	1	40763602	missense	probably benign	0.38
R0009:Slc9a2	UTSW	1	40763602	missense	probably benign	0.38
R0152:Slc9a2	UTSW	1	40742804	missense	probably damaging	1.00
R0374:Slc9a2	UTSW	1	40743857	missense	possibly damaging	0.93
R1386:Slc9a2	UTSW	1	40719018	missense	probably damaging	1.00
R1485:Slc9a2	UTSW	1	40726388	missense	probably damaging	1.00
R1712:Slc9a2	UTSW	1	40763610	missense	possibly damaging	0.90
R1779:Slc9a2	UTSW	1	40742643	missense	probably damaging	0.99
R2051:Slc9a2	UTSW	1	40726437	missense	probably damaging	1.00
R2166:Slc9a2	UTSW	1	40742768	missense	probably damaging	1.00
R2513:Slc9a2	UTSW	1	40742608	splice site	probably null
R3612:Slc9a2	UTSW	1	40719058	splice site	probably null
R4631:Slc9a2	UTSW	1	40761918	missense	possibly damaging	0.66
R4760:Slc9a2	UTSW	1	40761916	missense	probably damaging	1.00
R4768:Slc9a2	UTSW	1	40726374	missense	probably damaging	1.00
R4769:Slc9a2	UTSW	1	40726374	missense	probably damaging	1.00
R4920:Slc9a2	UTSW	1	40755718	missense	probably benign	0.05
R5191:Slc9a2	UTSW	1	40743893	missense	probably damaging	1.00
R5963:Slc9a2	UTSW	1	40682036	missense	possibly damaging	0.94
R6322:Slc9a2	UTSW	1	40742653	nonsense	probably null
R6453:Slc9a2	UTSW	1	40742621	missense	possibly damaging	0.64
R6685:Slc9a2	UTSW	1	40718909	missense	probably damaging	0.99
R7088:Slc9a2	UTSW	1	40726379	missense	probably damaging	1.00
R7302:Slc9a2	UTSW	1	40767668	missense	possibly damaging	0.58
R7450:Slc9a2	UTSW	1	40681835	start gained	probably benign
R7670:Slc9a2	UTSW	1	40718997	missense	probably damaging	1.00
R7970:Slc9a2	UTSW	1	40726214	missense	probably damaging	0.98
R8104:Slc9a2	UTSW	1	40718649	missense	probably damaging	1.00
R8776:Slc9a2	UTSW	1	40742729	missense	probably damaging	1.00
R8776-TAIL:Slc9a2	UTSW	1	40742729	missense	probably damaging	1.00
R8887:Slc9a2	UTSW	1	40718849	missense	probably benign	0.01
R9028:Slc9a2	UTSW	1	40726452	missense	probably damaging	1.00
R9189:Slc9a2	UTSW	1	40755784	missense	probably benign	0.21
R9245:Slc9a2	UTSW	1	40766300	missense	probably benign	0.27
R9250:Slc9a2	UTSW	1	40767827	missense	probably benign	0.00
R9400:Slc9a2	UTSW	1	40719051	missense	possibly damaging	0.65
R9512:Slc9a2	UTSW	1	40682098	missense	probably damaging	0.98
R9583:Slc9a2	UTSW	1	40681901	missense	probably benign
X0054:Slc9a2	UTSW	1	40742687	missense	probably damaging	0.99
Z1176:Slc9a2	UTSW	1	40767711	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTCATAATGGTCGGGCTTCTAC -3'
(R):5'- ATCGTTGAGCAGAGACTCGC -3'

Sequencing Primer
(F):5'- CTTCTACTGGGTGGGATTATCTTC -3'
(R):5'- CCAAAAACCAGGATATAGAGCTGTTC -3'

Posted On

2016-02-04