Incidental Mutation 'R4815:Ift122'
ID 369715
Institutional Source Beutler Lab
Gene Symbol Ift122
Ensembl Gene ENSMUSG00000030323
Gene Name intraflagellar transport 122
Synonyms C86139, sopb, Wdr10
MMRRC Submission 042433-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4815 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 115853470-115926699 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 115881556 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 166 (K166E)
Ref Sequence ENSEMBL: ENSMUSP00000045468 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038234] [ENSMUST00000112923] [ENSMUST00000112925] [ENSMUST00000141305]
AlphaFold Q6NWV3
Predicted Effect possibly damaging
Transcript: ENSMUST00000038234
AA Change: K166E

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000045468
Gene: ENSMUSG00000030323
AA Change: K166E

DomainStartEndE-ValueType
WD40 1 39 7.1e1 SMART
WD40 42 81 7.16e-10 SMART
WD40 83 120 1.54e0 SMART
WD40 122 160 1.43e0 SMART
WD40 162 208 2.29e1 SMART
WD40 210 249 1.91e1 SMART
WD40 251 290 3.45e-3 SMART
WD40 448 483 1.43e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112923
AA Change: K166E

PolyPhen 2 Score 0.651 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000108545
Gene: ENSMUSG00000030323
AA Change: K166E

DomainStartEndE-ValueType
WD40 1 39 7.1e1 SMART
WD40 42 81 7.16e-10 SMART
WD40 83 120 1.54e0 SMART
WD40 122 160 1.43e0 SMART
Blast:WD40 163 267 3e-46 BLAST
WD40 269 308 1.91e1 SMART
WD40 310 349 3.45e-3 SMART
WD40 507 542 1.43e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112925
AA Change: K166E

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000108547
Gene: ENSMUSG00000030323
AA Change: K166E

DomainStartEndE-ValueType
WD40 1 39 7.1e1 SMART
WD40 42 81 7.16e-10 SMART
WD40 83 120 1.54e0 SMART
WD40 122 160 1.43e0 SMART
WD40 162 208 2.29e1 SMART
WD40 210 249 1.91e1 SMART
WD40 251 290 3.45e-3 SMART
WD40 448 483 1.43e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138113
Predicted Effect probably benign
Transcript: ENSMUST00000141305
SMART Domains Protein: ENSMUSP00000138535
Gene: ENSMUSG00000030323

DomainStartEndE-ValueType
WD40 1 39 7.1e1 SMART
WD40 42 81 7.16e-10 SMART
WD40 83 120 1.54e0 SMART
low complexity region 124 134 N/A INTRINSIC
low complexity region 162 176 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149083
Meta Mutation Damage Score 0.2002 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 96% (76/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This cytoplasmic protein contains seven WD repeats and an AF-2 domain which function by recruiting coregulatory molecules and in transcriptional activation. Mutations in this gene cause cranioectodermal dysplasia-1. A related pseudogene is located on chromosome 3. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygotes for a null mutation display embryonic lethality during organogenesis with exencephaly, a ventralized caudal neural tube, preaxial polydactyly, abnormal cilia, and left-right patterning defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk2 A T 18: 65,349,955 N327K probably damaging Het
Ank2 T C 3: 126,936,761 T675A probably benign Het
Arap3 T C 18: 37,973,243 T1516A probably benign Het
Asb18 A T 1: 90,014,425 N51K probably damaging Het
BC003331 A G 1: 150,374,846 C294R probably damaging Het
C7 A G 15: 5,059,405 V18A probably benign Het
Caap1 A G 4: 94,501,260 V279A probably benign Het
Cacnb2 A G 2: 14,874,780 D21G probably damaging Het
Ccdc171 T C 4: 83,795,221 S1166P probably damaging Het
Chgb A T 2: 132,793,299 H387L probably benign Het
Chp2 G A 7: 122,220,900 R91Q probably damaging Het
Chuk C A 19: 44,077,247 G703* probably null Het
Clmn T C 12: 104,785,566 D210G probably damaging Het
Cyp4f18 A G 8: 71,995,995 V270A possibly damaging Het
Dgcr2 A G 16: 17,858,619 probably benign Het
Diaph1 A T 18: 37,895,203 V411D unknown Het
Dkk2 C T 3: 132,173,785 A75V probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dnase2a T C 8: 84,909,877 V187A probably benign Het
Dusp19 A G 2: 80,630,945 M193V probably benign Het
Ear-ps2 G A 14: 44,047,060 noncoding transcript Het
Gm37596 C T 3: 93,692,286 V259M probably benign Het
Golgb1 A T 16: 36,913,115 Q908L possibly damaging Het
Hsp90aa1 T C 12: 110,695,226 M119V possibly damaging Het
Ice2 C T 9: 69,407,118 R50C probably damaging Het
Ifi208 A T 1: 173,682,837 E186V probably damaging Het
Jcad T A 18: 4,675,223 L995Q possibly damaging Het
Kcnc4 A T 3: 107,458,266 C209S probably benign Het
Kmt2a G A 9: 44,821,256 probably benign Het
Lrriq1 T A 10: 103,144,878 L1465F probably benign Het
Map3k7 C A 4: 31,988,592 T247N probably damaging Het
Mctp2 T G 7: 72,259,349 Q72P possibly damaging Het
Miga1 T C 3: 152,290,806 Y335C probably benign Het
Ms4a14 A T 19: 11,314,277 N19K probably benign Het
Mylk G A 16: 34,894,925 R541Q probably damaging Het
Nav3 T C 10: 109,823,552 T735A probably benign Het
Nlgn1 T A 3: 25,436,030 H511L probably damaging Het
Nlrp4a A T 7: 26,450,808 E613D probably benign Het
Nuf2 A G 1: 169,510,468 S247P probably damaging Het
Ocstamp A G 2: 165,398,182 V28A probably benign Het
Odf2 A C 2: 29,902,240 E155D possibly damaging Het
Olfr285 T C 15: 98,312,680 N290S probably damaging Het
Olfr695 G A 7: 106,874,237 P3S probably benign Het
Otud7a T C 7: 63,729,910 probably null Het
Pacsin2 A T 15: 83,385,059 D11E probably damaging Het
Pcdhga5 G A 18: 37,695,194 V232I probably damaging Het
Plcb3 A G 19: 6,962,984 I439T possibly damaging Het
Rag1 A G 2: 101,643,516 V427A probably damaging Het
Ranbp10 A T 8: 105,826,125 C128* probably null Het
Rbm8a2 A G 1: 175,978,458 V151A probably damaging Het
S100pbp A G 4: 129,150,933 probably benign Het
Serpinb5 G T 1: 106,872,339 L86F probably damaging Het
Sgo2b T C 8: 63,931,414 I183V probably benign Het
Slc25a25 A T 2: 32,420,410 D112E probably damaging Het
Slc30a5 C T 13: 100,813,710 V103I probably damaging Het
Slc9a2 A T 1: 40,718,849 I183F probably benign Het
Srrm4 T A 5: 116,475,190 K141N unknown Het
Tbc1d20 T C 2: 152,311,989 probably benign Het
Tep1 A G 14: 50,841,302 L1498P probably damaging Het
Tgfbi T C 13: 56,632,120 M494T probably benign Het
Tox A G 4: 6,823,033 S95P probably benign Het
Tpr G A 1: 150,398,608 V163I probably benign Het
Trpm7 A G 2: 126,858,492 S2P probably damaging Het
Ttn A G 2: 76,716,085 M32328T probably damaging Het
Vps39 A T 2: 120,338,559 N289K probably benign Het
Xdh C T 17: 73,906,215 A847T probably damaging Het
Xndc1 G A 7: 102,073,316 G63R probably null Het
Ythdc2 A G 18: 44,885,240 S1330G probably benign Het
Zc3h14 C G 12: 98,752,848 D157E probably damaging Het
Zc3h7b A T 15: 81,793,663 K949N probably damaging Het
Zp3r A T 1: 130,598,912 Y185N probably damaging Het
Other mutations in Ift122
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Ift122 APN 6 115917057 missense probably benign 0.10
IGL00783:Ift122 APN 6 115905902 missense probably benign
IGL00784:Ift122 APN 6 115905902 missense probably benign
IGL00799:Ift122 APN 6 115877536 missense probably damaging 1.00
IGL00908:Ift122 APN 6 115913909 missense probably benign 0.00
IGL01012:Ift122 APN 6 115899491 missense probably damaging 0.99
IGL01444:Ift122 APN 6 115884379 missense probably benign 0.08
IGL01451:Ift122 APN 6 115912604 critical splice donor site probably null
IGL01940:Ift122 APN 6 115887371 splice site probably benign
IGL02089:Ift122 APN 6 115925437 missense probably benign 0.00
IGL02331:Ift122 APN 6 115887324 missense probably damaging 1.00
IGL02929:Ift122 APN 6 115902877 missense probably damaging 1.00
IGL03169:Ift122 APN 6 115905961 splice site probably benign
PIT1430001:Ift122 UTSW 6 115925744 splice site probably benign
R0158:Ift122 UTSW 6 115924484 splice site probably benign
R0496:Ift122 UTSW 6 115905902 missense probably benign
R1065:Ift122 UTSW 6 115875325 splice site probably null
R1670:Ift122 UTSW 6 115923883 missense probably benign 0.05
R1861:Ift122 UTSW 6 115891928 missense probably damaging 1.00
R1889:Ift122 UTSW 6 115894421 critical splice donor site probably null
R1990:Ift122 UTSW 6 115924367 missense probably damaging 1.00
R2362:Ift122 UTSW 6 115884350 missense probably damaging 0.99
R2385:Ift122 UTSW 6 115912522 missense probably benign 0.21
R3734:Ift122 UTSW 6 115925501 splice site probably benign
R3800:Ift122 UTSW 6 115925906 missense probably benign 0.03
R3981:Ift122 UTSW 6 115913921 missense probably benign 0.02
R4289:Ift122 UTSW 6 115923891 missense probably damaging 1.00
R4545:Ift122 UTSW 6 115890588 missense probably damaging 1.00
R4546:Ift122 UTSW 6 115890588 missense probably damaging 1.00
R4641:Ift122 UTSW 6 115888765 nonsense probably null
R4854:Ift122 UTSW 6 115862746 missense possibly damaging 0.61
R4928:Ift122 UTSW 6 115915858 utr 3 prime probably benign
R5021:Ift122 UTSW 6 115864372 missense probably benign 0.41
R5121:Ift122 UTSW 6 115912534 missense probably benign 0.04
R5200:Ift122 UTSW 6 115920379 missense probably damaging 0.99
R5549:Ift122 UTSW 6 115892022 missense probably damaging 1.00
R6111:Ift122 UTSW 6 115875286 missense probably damaging 1.00
R6141:Ift122 UTSW 6 115916011 missense probably damaging 0.99
R6766:Ift122 UTSW 6 115926243 missense probably benign 0.15
R7379:Ift122 UTSW 6 115926302 missense probably benign
R7402:Ift122 UTSW 6 115894322 missense probably benign 0.00
R7436:Ift122 UTSW 6 115926302 missense probably benign
R7437:Ift122 UTSW 6 115926302 missense probably benign
R7438:Ift122 UTSW 6 115926302 missense probably benign
R7517:Ift122 UTSW 6 115890582 missense probably benign 0.37
R7978:Ift122 UTSW 6 115920352 missense probably benign 0.37
R8492:Ift122 UTSW 6 115887005 missense probably benign 0.02
R8493:Ift122 UTSW 6 115910331 missense probably benign 0.01
R8669:Ift122 UTSW 6 115923291 missense probably damaging 0.98
R8867:Ift122 UTSW 6 115880671 missense probably damaging 1.00
R8887:Ift122 UTSW 6 115891919 missense probably benign 0.00
R8947:Ift122 UTSW 6 115924407 missense probably benign
R8978:Ift122 UTSW 6 115925808 missense possibly damaging 0.78
R9149:Ift122 UTSW 6 115890531 missense probably damaging 1.00
Z1176:Ift122 UTSW 6 115915994 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAGTGGCAGTCTGAGCTGAG -3'
(R):5'- TTCCAAACAGACCAGGGAAG -3'

Sequencing Primer
(F):5'- CTGAGTCTATGTCAGGAATACGC -3'
(R):5'- GTGGGAGAGAGGACTTTAAACTAC -3'
Posted On 2016-02-04