Incidental Mutation 'R4815:Nlrp4a'
ID369716
Institutional Source Beutler Lab
Gene Symbol Nlrp4a
Ensembl Gene ENSMUSG00000040601
Gene NameNLR family, pyrin domain containing 4A
SynonymsE330028A19Rik, Nalp-eta, Nalp4a
MMRRC Submission 042433-MU
Accession Numbers

Genbank: NM_172896; MGI: 2443697

Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R4815 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location26435113-26476142 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 26450808 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 613 (E613D)
Ref Sequence ENSEMBL: ENSMUSP00000146044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068767] [ENSMUST00000119386] [ENSMUST00000146907]
Predicted Effect probably benign
Transcript: ENSMUST00000068767
AA Change: E613D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000066841
Gene: ENSMUSG00000040601
AA Change: E613D

DomainStartEndE-ValueType
PYRIN 6 89 6.48e-34 SMART
Pfam:NACHT 148 317 4.9e-37 PFAM
Blast:LRR 634 661 4e-6 BLAST
low complexity region 666 677 N/A INTRINSIC
LRR 689 716 5.96e0 SMART
LRR 718 745 1.99e1 SMART
LRR 746 772 1.02e0 SMART
LRR 774 801 4.66e1 SMART
LRR 802 829 1.18e-2 SMART
LRR 831 858 2.2e-2 SMART
LRR 859 886 5.59e-4 SMART
LRR 888 915 9.41e0 SMART
LRR 916 943 8.94e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119386
AA Change: E613D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112441
Gene: ENSMUSG00000040601
AA Change: E613D

DomainStartEndE-ValueType
PYRIN 6 89 6.48e-34 SMART
Pfam:NACHT 148 317 1.3e-37 PFAM
Blast:LRR 634 661 4e-6 BLAST
low complexity region 666 677 N/A INTRINSIC
LRR 689 716 5.96e0 SMART
LRR 718 745 1.99e1 SMART
LRR 746 772 1.02e0 SMART
LRR 774 801 4.66e1 SMART
LRR 802 829 1.18e-2 SMART
LRR 831 858 2.2e-2 SMART
LRR 859 886 5.59e-4 SMART
LRR 888 915 9.41e0 SMART
LRR 916 943 8.94e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146534
Predicted Effect probably benign
Transcript: ENSMUST00000146907
AA Change: E613D

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Meta Mutation Damage Score 0.1356 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 96% (76/79)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk2 A T 18: 65,349,955 N327K probably damaging Het
Ank2 T C 3: 126,936,761 T675A probably benign Het
Arap3 T C 18: 37,973,243 T1516A probably benign Het
Asb18 A T 1: 90,014,425 N51K probably damaging Het
BC003331 A G 1: 150,374,846 C294R probably damaging Het
C7 A G 15: 5,059,405 V18A probably benign Het
Caap1 A G 4: 94,501,260 V279A probably benign Het
Cacnb2 A G 2: 14,874,780 D21G probably damaging Het
Ccdc171 T C 4: 83,795,221 S1166P probably damaging Het
Chgb A T 2: 132,793,299 H387L probably benign Het
Chp2 G A 7: 122,220,900 R91Q probably damaging Het
Chuk C A 19: 44,077,247 G703* probably null Het
Clmn T C 12: 104,785,566 D210G probably damaging Het
Cyp4f18 A G 8: 71,995,995 V270A possibly damaging Het
Dgcr2 A G 16: 17,858,619 probably benign Het
Diaph1 A T 18: 37,895,203 V411D unknown Het
Dkk2 C T 3: 132,173,785 A75V probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dnase2a T C 8: 84,909,877 V187A probably benign Het
Dusp19 A G 2: 80,630,945 M193V probably benign Het
Ear-ps2 G A 14: 44,047,060 noncoding transcript Het
Gm37596 C T 3: 93,692,286 V259M probably benign Het
Golgb1 A T 16: 36,913,115 Q908L possibly damaging Het
Hsp90aa1 T C 12: 110,695,226 M119V possibly damaging Het
Ice2 C T 9: 69,407,118 R50C probably damaging Het
Ifi208 A T 1: 173,682,837 E186V probably damaging Het
Ift122 A G 6: 115,881,556 K166E possibly damaging Het
Jcad T A 18: 4,675,223 L995Q possibly damaging Het
Kcnc4 A T 3: 107,458,266 C209S probably benign Het
Kmt2a G A 9: 44,821,256 probably benign Het
Lrriq1 T A 10: 103,144,878 L1465F probably benign Het
Map3k7 C A 4: 31,988,592 T247N probably damaging Het
Mctp2 T G 7: 72,259,349 Q72P possibly damaging Het
Miga1 T C 3: 152,290,806 Y335C probably benign Het
Ms4a14 A T 19: 11,314,277 N19K probably benign Het
Mylk G A 16: 34,894,925 R541Q probably damaging Het
Nav3 T C 10: 109,823,552 T735A probably benign Het
Nlgn1 T A 3: 25,436,030 H511L probably damaging Het
Nuf2 A G 1: 169,510,468 S247P probably damaging Het
Ocstamp A G 2: 165,398,182 V28A probably benign Het
Odf2 A C 2: 29,902,240 E155D possibly damaging Het
Olfr285 T C 15: 98,312,680 N290S probably damaging Het
Olfr695 G A 7: 106,874,237 P3S probably benign Het
Otud7a T C 7: 63,729,910 probably null Het
Pacsin2 A T 15: 83,385,059 D11E probably damaging Het
Pcdhga5 G A 18: 37,695,194 V232I probably damaging Het
Plcb3 A G 19: 6,962,984 I439T possibly damaging Het
Rag1 A G 2: 101,643,516 V427A probably damaging Het
Ranbp10 A T 8: 105,826,125 C128* probably null Het
Rbm8a2 A G 1: 175,978,458 V151A probably damaging Het
S100pbp A G 4: 129,150,933 probably benign Het
Serpinb5 G T 1: 106,872,339 L86F probably damaging Het
Sgo2b T C 8: 63,931,414 I183V probably benign Het
Slc25a25 A T 2: 32,420,410 D112E probably damaging Het
Slc30a5 C T 13: 100,813,710 V103I probably damaging Het
Slc9a2 A T 1: 40,718,849 I183F probably benign Het
Srrm4 T A 5: 116,475,190 K141N unknown Het
Tbc1d20 T C 2: 152,311,989 probably benign Het
Tep1 A G 14: 50,841,302 L1498P probably damaging Het
Tgfbi T C 13: 56,632,120 M494T probably benign Het
Tox A G 4: 6,823,033 S95P probably benign Het
Tpr G A 1: 150,398,608 V163I probably benign Het
Trpm7 A G 2: 126,858,492 S2P probably damaging Het
Ttn A G 2: 76,716,085 M32328T probably damaging Het
Vps39 A T 2: 120,338,559 N289K probably benign Het
Xdh C T 17: 73,906,215 A847T probably damaging Het
Xndc1 G A 7: 102,073,316 G63R probably null Het
Ythdc2 A G 18: 44,885,240 S1330G probably benign Het
Zc3h14 C G 12: 98,752,848 D157E probably damaging Het
Zc3h7b A T 15: 81,793,663 K949N probably damaging Het
Zp3r A T 1: 130,598,912 Y185N probably damaging Het
Other mutations in Nlrp4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00487:Nlrp4a APN 7 26449985 missense possibly damaging 0.51
IGL00972:Nlrp4a APN 7 26457048 missense probably benign
IGL01081:Nlrp4a APN 7 26449829 missense probably benign 0.06
IGL01788:Nlrp4a APN 7 26454067 missense probably benign 0.17
IGL02001:Nlrp4a APN 7 26449969 missense probably benign 0.01
IGL02070:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02175:Nlrp4a APN 7 26475097 missense probably damaging 1.00
IGL02193:Nlrp4a APN 7 26459692 missense probably damaging 1.00
IGL02193:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02197:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02200:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02202:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02207:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02237:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02240:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02658:Nlrp4a APN 7 26449713 missense probably benign 0.43
IGL02743:Nlrp4a APN 7 26459815 splice site probably benign
IGL02960:Nlrp4a APN 7 26449730 missense probably benign 0.05
IGL03064:Nlrp4a APN 7 26449509 missense probably benign 0.23
IGL03276:Nlrp4a APN 7 26464190 missense probably damaging 1.00
BB002:Nlrp4a UTSW 7 26450586 missense probably benign 0.10
BB012:Nlrp4a UTSW 7 26450586 missense probably benign 0.10
D3080:Nlrp4a UTSW 7 26444341 missense probably benign 0.22
P0019:Nlrp4a UTSW 7 26449637 missense probably damaging 1.00
R0020:Nlrp4a UTSW 7 26450372 missense probably damaging 1.00
R0240:Nlrp4a UTSW 7 26462516 missense probably benign 0.00
R0240:Nlrp4a UTSW 7 26462516 missense probably benign 0.00
R0372:Nlrp4a UTSW 7 26449232 splice site probably benign
R0466:Nlrp4a UTSW 7 26462620 splice site probably benign
R0544:Nlrp4a UTSW 7 26457130 missense probably benign 0.00
R1006:Nlrp4a UTSW 7 26453467 missense probably benign 0.30
R1072:Nlrp4a UTSW 7 26444435 missense probably damaging 1.00
R1432:Nlrp4a UTSW 7 26464197 frame shift probably null
R1655:Nlrp4a UTSW 7 26449651 missense possibly damaging 0.56
R1696:Nlrp4a UTSW 7 26450534 missense probably damaging 1.00
R2041:Nlrp4a UTSW 7 26450186 missense probably damaging 0.97
R2091:Nlrp4a UTSW 7 26450153 missense probably damaging 1.00
R2163:Nlrp4a UTSW 7 26453397 missense probably benign 0.00
R2174:Nlrp4a UTSW 7 26449424 missense probably damaging 1.00
R2319:Nlrp4a UTSW 7 26449894 missense probably benign 0.10
R2358:Nlrp4a UTSW 7 26464198 missense probably benign 0.03
R2680:Nlrp4a UTSW 7 26449230 splice site probably null
R3812:Nlrp4a UTSW 7 26449693 missense probably benign
R4114:Nlrp4a UTSW 7 26449940 missense probably damaging 1.00
R4664:Nlrp4a UTSW 7 26449518 nonsense probably null
R4676:Nlrp4a UTSW 7 26450229 missense probably damaging 1.00
R4708:Nlrp4a UTSW 7 26464108 missense probably benign 0.00
R4728:Nlrp4a UTSW 7 26475090 missense probably benign 0.24
R4831:Nlrp4a UTSW 7 26450419 missense possibly damaging 0.92
R5007:Nlrp4a UTSW 7 26462480 missense probably damaging 0.99
R5253:Nlrp4a UTSW 7 26450492 missense probably benign 0.00
R5262:Nlrp4a UTSW 7 26459811 critical splice donor site probably null
R5441:Nlrp4a UTSW 7 26454153 missense probably damaging 1.00
R5639:Nlrp4a UTSW 7 26457030 missense probably benign 0.02
R5641:Nlrp4a UTSW 7 26450164 missense probably damaging 1.00
R5771:Nlrp4a UTSW 7 26453389 missense probably damaging 1.00
R6312:Nlrp4a UTSW 7 26449396 missense probably benign 0.11
R7131:Nlrp4a UTSW 7 26449833 missense probably benign 0.21
R7149:Nlrp4a UTSW 7 26450438 missense probably benign 0.00
R7348:Nlrp4a UTSW 7 26444273 missense probably damaging 1.00
R7384:Nlrp4a UTSW 7 26449538 missense not run
R7548:Nlrp4a UTSW 7 26450179 missense probably damaging 1.00
R7566:Nlrp4a UTSW 7 26449245 critical splice acceptor site probably null
R7646:Nlrp4a UTSW 7 26449562 missense probably damaging 0.96
R7692:Nlrp4a UTSW 7 26449265 missense probably benign 0.01
R7902:Nlrp4a UTSW 7 26450057 missense possibly damaging 0.65
R7925:Nlrp4a UTSW 7 26450586 missense probably benign 0.10
R7937:Nlrp4a UTSW 7 26464146 missense probably benign 0.00
R7992:Nlrp4a UTSW 7 26450645 missense possibly damaging 0.51
R8205:Nlrp4a UTSW 7 26450794 missense probably benign
R8477:Nlrp4a UTSW 7 26459794 missense probably benign
R8704:Nlrp4a UTSW 7 26457138 missense probably benign 0.02
T0975:Nlrp4a UTSW 7 26449637 missense probably damaging 1.00
X0022:Nlrp4a UTSW 7 26444342 missense probably damaging 0.99
Z1088:Nlrp4a UTSW 7 26454163 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGATGGACGATGACACCTTC -3'
(R):5'- TGTCCCTAATGTGCACCACC -3'

Sequencing Primer
(F):5'- GGACGATGACACCTTCTTAGTAG -3'
(R):5'- GCACACACAATCTGTTGAGTTTGC -3'
Posted On2016-02-04