Mutagenetix > Incidental Mutations

Incidental Mutation 'R4815:Nav3'

369729

Institutional Source

Beutler Lab

Gene Symbol

Nav3

Ensembl Gene

ENSMUSG00000020181

Gene Name

neuron navigator 3

Synonyms

POMFIL1, 9630020C08Rik, 4732483H20Rik, unc53H3, steerin 3, Pomfil1p

MMRRC Submission

042433-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4815 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

109681259-110456204 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 109823552 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 735 (T735A)

Ref Sequence

ENSEMBL: ENSMUSP00000032719 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032719]

Predicted Effect

probably benign
Transcript: ENSMUST00000032719
AA Change: T735A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000032719
Gene: ENSMUSG00000020181
AA Change: T735A

Domain	Start	End	E-Value	Type
CH	79	182	4.41e-12	SMART
low complexity region	184	194	N/A	INTRINSIC
low complexity region	318	329	N/A	INTRINSIC
low complexity region	353	363	N/A	INTRINSIC
low complexity region	427	439	N/A	INTRINSIC
low complexity region	522	536	N/A	INTRINSIC
low complexity region	713	724	N/A	INTRINSIC
low complexity region	807	818	N/A	INTRINSIC
low complexity region	873	896	N/A	INTRINSIC
low complexity region	904	916	N/A	INTRINSIC
low complexity region	1077	1095	N/A	INTRINSIC
low complexity region	1160	1173	N/A	INTRINSIC
low complexity region	1207	1229	N/A	INTRINSIC
low complexity region	1256	1266	N/A	INTRINSIC
low complexity region	1274	1285	N/A	INTRINSIC
low complexity region	1293	1312	N/A	INTRINSIC
low complexity region	1327	1341	N/A	INTRINSIC
low complexity region	1383	1397	N/A	INTRINSIC
low complexity region	1462	1474	N/A	INTRINSIC
low complexity region	1550	1563	N/A	INTRINSIC
coiled coil region	1565	1656	N/A	INTRINSIC
low complexity region	1675	1692	N/A	INTRINSIC
low complexity region	1722	1733	N/A	INTRINSIC
low complexity region	1756	1781	N/A	INTRINSIC
low complexity region	1782	1795	N/A	INTRINSIC
coiled coil region	1801	1842	N/A	INTRINSIC
low complexity region	1848	1871	N/A	INTRINSIC
AAA	2029	2184	4.94e-7	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161582

SMART Domains

Protein: ENSMUSP00000124591
Gene: ENSMUSG00000020181

Domain	Start	End	E-Value	Type
low complexity region	84	95	N/A	INTRINSIC
low complexity region	150	173	N/A	INTRINSIC
low complexity region	181	193	N/A	INTRINSIC
low complexity region	354	372	N/A	INTRINSIC
low complexity region	437	450	N/A	INTRINSIC
low complexity region	484	506	N/A	INTRINSIC
low complexity region	533	543	N/A	INTRINSIC
low complexity region	551	562	N/A	INTRINSIC
low complexity region	570	589	N/A	INTRINSIC
low complexity region	604	618	N/A	INTRINSIC
low complexity region	660	674	N/A	INTRINSIC
low complexity region	739	751	N/A	INTRINSIC
low complexity region	827	840	N/A	INTRINSIC
coiled coil region	842	933	N/A	INTRINSIC
low complexity region	952	969	N/A	INTRINSIC
low complexity region	992	1003	N/A	INTRINSIC
low complexity region	1026	1051	N/A	INTRINSIC
low complexity region	1052	1065	N/A	INTRINSIC
coiled coil region	1071	1112	N/A	INTRINSIC
low complexity region	1118	1141	N/A	INTRINSIC
AAA	1299	1454	4.94e-7	SMART

Meta Mutation Damage Score

0.0603

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.5%

Validation Efficiency

96% (76/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the neuron navigator family and is expressed predominantly in the nervous system. The encoded protein contains coiled-coil domains and a conserved AAA domain characteristic for ATPases associated with a variety of cellular activities. This gene is similar to unc-53, a Caenorhabditis elegans gene involved in axon guidance. Multiple alternatively spliced transcript variants for this gene have been described but only one has had its full-length nature determined. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alpk2	A	T	18: 65,349,955	N327K	probably damaging	Het
Ank2	T	C	3: 126,936,761	T675A	probably benign	Het
Arap3	T	C	18: 37,973,243	T1516A	probably benign	Het
Asb18	A	T	1: 90,014,425	N51K	probably damaging	Het
BC003331	A	G	1: 150,374,846	C294R	probably damaging	Het
C7	A	G	15: 5,059,405	V18A	probably benign	Het
Caap1	A	G	4: 94,501,260	V279A	probably benign	Het
Cacnb2	A	G	2: 14,874,780	D21G	probably damaging	Het
Ccdc171	T	C	4: 83,795,221	S1166P	probably damaging	Het
Chgb	A	T	2: 132,793,299	H387L	probably benign	Het
Chp2	G	A	7: 122,220,900	R91Q	probably damaging	Het
Chuk	C	A	19: 44,077,247	G703*	probably null	Het
Clmn	T	C	12: 104,785,566	D210G	probably damaging	Het
Cyp4f18	A	G	8: 71,995,995	V270A	possibly damaging	Het
Dgcr2	A	G	16: 17,858,619		probably benign	Het
Diaph1	A	T	18: 37,895,203	V411D	unknown	Het
Dkk2	C	T	3: 132,173,785	A75V	probably benign	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Dnase2a	T	C	8: 84,909,877	V187A	probably benign	Het
Dusp19	A	G	2: 80,630,945	M193V	probably benign	Het
Ear-ps2	G	A	14: 44,047,060		noncoding transcript	Het
Gm37596	C	T	3: 93,692,286	V259M	probably benign	Het
Golgb1	A	T	16: 36,913,115	Q908L	possibly damaging	Het
Hsp90aa1	T	C	12: 110,695,226	M119V	possibly damaging	Het
Ice2	C	T	9: 69,407,118	R50C	probably damaging	Het
Ifi208	A	T	1: 173,682,837	E186V	probably damaging	Het
Ift122	A	G	6: 115,881,556	K166E	possibly damaging	Het
Jcad	T	A	18: 4,675,223	L995Q	possibly damaging	Het
Kcnc4	A	T	3: 107,458,266	C209S	probably benign	Het
Kmt2a	G	A	9: 44,821,256		probably benign	Het
Lrriq1	T	A	10: 103,144,878	L1465F	probably benign	Het
Map3k7	C	A	4: 31,988,592	T247N	probably damaging	Het
Mctp2	T	G	7: 72,259,349	Q72P	possibly damaging	Het
Miga1	T	C	3: 152,290,806	Y335C	probably benign	Het
Ms4a14	A	T	19: 11,314,277	N19K	probably benign	Het
Mylk	G	A	16: 34,894,925	R541Q	probably damaging	Het
Nlgn1	T	A	3: 25,436,030	H511L	probably damaging	Het
Nlrp4a	A	T	7: 26,450,808	E613D	probably benign	Het
Nuf2	A	G	1: 169,510,468	S247P	probably damaging	Het
Ocstamp	A	G	2: 165,398,182	V28A	probably benign	Het
Odf2	A	C	2: 29,902,240	E155D	possibly damaging	Het
Olfr285	T	C	15: 98,312,680	N290S	probably damaging	Het
Olfr695	G	A	7: 106,874,237	P3S	probably benign	Het
Otud7a	T	C	7: 63,729,910		probably null	Het
Pacsin2	A	T	15: 83,385,059	D11E	probably damaging	Het
Pcdhga5	G	A	18: 37,695,194	V232I	probably damaging	Het
Plcb3	A	G	19: 6,962,984	I439T	possibly damaging	Het
Rag1	A	G	2: 101,643,516	V427A	probably damaging	Het
Ranbp10	A	T	8: 105,826,125	C128*	probably null	Het
Rbm8a2	A	G	1: 175,978,458	V151A	probably damaging	Het
S100pbp	A	G	4: 129,150,933		probably benign	Het
Serpinb5	G	T	1: 106,872,339	L86F	probably damaging	Het
Sgo2b	T	C	8: 63,931,414	I183V	probably benign	Het
Slc25a25	A	T	2: 32,420,410	D112E	probably damaging	Het
Slc30a5	C	T	13: 100,813,710	V103I	probably damaging	Het
Slc9a2	A	T	1: 40,718,849	I183F	probably benign	Het
Srrm4	T	A	5: 116,475,190	K141N	unknown	Het
Tbc1d20	T	C	2: 152,311,989		probably benign	Het
Tep1	A	G	14: 50,841,302	L1498P	probably damaging	Het
Tgfbi	T	C	13: 56,632,120	M494T	probably benign	Het
Tox	A	G	4: 6,823,033	S95P	probably benign	Het
Tpr	G	A	1: 150,398,608	V163I	probably benign	Het
Trpm7	A	G	2: 126,858,492	S2P	probably damaging	Het
Ttn	A	G	2: 76,716,085	M32328T	probably damaging	Het
Vps39	A	T	2: 120,338,559	N289K	probably benign	Het
Xdh	C	T	17: 73,906,215	A847T	probably damaging	Het
Xndc1	G	A	7: 102,073,316	G63R	probably null	Het
Ythdc2	A	G	18: 44,885,240	S1330G	probably benign	Het
Zc3h14	C	G	12: 98,752,848	D157E	probably damaging	Het
Zc3h7b	A	T	15: 81,793,663	K949N	probably damaging	Het
Zp3r	A	T	1: 130,598,912	Y185N	probably damaging	Het

Other mutations in Nav3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Nav3	APN	10	109841733	missense	probably damaging	0.99
IGL00425:Nav3	APN	10	109703507	missense	probably benign	0.13
IGL00465:Nav3	APN	10	109852746	missense	probably damaging	0.99
IGL00531:Nav3	APN	10	109703310	missense	probably null	0.99
IGL00575:Nav3	APN	10	109764765	missense	probably damaging	0.98
IGL00770:Nav3	APN	10	109816263	missense	probably damaging	1.00
IGL00774:Nav3	APN	10	109816263	missense	probably damaging	1.00
IGL00858:Nav3	APN	10	109742632	missense	probably damaging	0.98
IGL00935:Nav3	APN	10	109705666	missense	probably benign
IGL01638:Nav3	APN	10	109852863	missense	probably damaging	1.00
IGL01662:Nav3	APN	10	109769258	missense	possibly damaging	0.56
IGL01670:Nav3	APN	10	109714241	missense	possibly damaging	0.92
IGL01885:Nav3	APN	10	109742660	nonsense	probably null
IGL01979:Nav3	APN	10	109704929	missense	probably benign	0.01
IGL02121:Nav3	APN	10	109759036	missense	probably damaging	0.99
IGL02210:Nav3	APN	10	109766990	missense	probably benign
IGL02523:Nav3	APN	10	109769296	missense	probably damaging	1.00
IGL02573:Nav3	APN	10	109866974	missense	probably benign	0.23
IGL02633:Nav3	APN	10	109692136	missense	probably benign	0.09
IGL02810:Nav3	APN	10	109816274	missense	probably damaging	1.00
IGL02964:Nav3	APN	10	109736953	missense	probably damaging	0.99
IGL03015:Nav3	APN	10	109718297	missense	probably damaging	0.98
IGL03288:Nav3	APN	10	109759017	missense	probably damaging	1.00
IGL03310:Nav3	APN	10	109824572	critical splice donor site	probably null
PIT4377001:Nav3	UTSW	10	109716605	missense	probably damaging	0.99
R0010:Nav3	UTSW	10	109823226	splice site	probably benign
R0043:Nav3	UTSW	10	109767518	missense	possibly damaging	0.95
R0053:Nav3	UTSW	10	109766917	splice site	probably benign
R0053:Nav3	UTSW	10	109766917	splice site	probably benign
R0077:Nav3	UTSW	10	109716642	missense	possibly damaging	0.87
R0219:Nav3	UTSW	10	109866930	critical splice donor site	probably null
R0310:Nav3	UTSW	10	109767128	missense	possibly damaging	0.82
R0380:Nav3	UTSW	10	109758879	splice site	probably benign
R0403:Nav3	UTSW	10	109767103	missense	probably damaging	0.98
R0480:Nav3	UTSW	10	109853300	missense	probably damaging	1.00
R0626:Nav3	UTSW	10	109823464	missense	probably damaging	1.00
R0637:Nav3	UTSW	10	109770197	missense	probably benign	0.25
R0847:Nav3	UTSW	10	109903857	missense	possibly damaging	0.94
R0988:Nav3	UTSW	10	109716528	missense	probably damaging	1.00
R1272:Nav3	UTSW	10	109736999	missense	probably damaging	0.98
R1295:Nav3	UTSW	10	109692102	missense	probably damaging	1.00
R1405:Nav3	UTSW	10	109770333	splice site	probably benign
R1406:Nav3	UTSW	10	109883634	missense	possibly damaging	0.64
R1406:Nav3	UTSW	10	109883634	missense	possibly damaging	0.64
R1420:Nav3	UTSW	10	109823254	missense	probably benign	0.02
R1449:Nav3	UTSW	10	109853511	missense	probably benign	0.13
R1458:Nav3	UTSW	10	109720044	missense	probably damaging	1.00
R1469:Nav3	UTSW	10	109760508	missense	probably damaging	1.00
R1469:Nav3	UTSW	10	109760508	missense	probably damaging	1.00
R1472:Nav3	UTSW	10	109727941	missense	probably damaging	0.99
R1537:Nav3	UTSW	10	109866985	missense	probably damaging	1.00
R1539:Nav3	UTSW	10	109767170	missense	probably damaging	0.99
R1581:Nav3	UTSW	10	109823428	missense	probably damaging	1.00
R1586:Nav3	UTSW	10	109853254	missense	probably damaging	1.00
R1654:Nav3	UTSW	10	109853123	missense	possibly damaging	0.85
R1725:Nav3	UTSW	10	109823590	missense	probably damaging	1.00
R1742:Nav3	UTSW	10	109769213	missense	probably benign
R1793:Nav3	UTSW	10	109703372	missense	probably benign	0.00
R1830:Nav3	UTSW	10	109823323	missense	probably damaging	1.00
R1834:Nav3	UTSW	10	109720022	missense	probably damaging	0.99
R1881:Nav3	UTSW	10	109852559	missense	probably damaging	0.96
R1922:Nav3	UTSW	10	109705606	missense	probably benign	0.43
R1944:Nav3	UTSW	10	109716530	missense	probably damaging	0.99
R1981:Nav3	UTSW	10	109719090	splice site	probably benign
R1985:Nav3	UTSW	10	109770184	splice site	probably benign
R1996:Nav3	UTSW	10	109853401	missense	probably damaging	1.00
R2051:Nav3	UTSW	10	109824675	missense	probably damaging	0.99
R2062:Nav3	UTSW	10	109720021	missense	probably damaging	1.00
R2139:Nav3	UTSW	10	109853135	missense	probably benign	0.22
R2248:Nav3	UTSW	10	109696227	missense	probably damaging	1.00
R2420:Nav3	UTSW	10	109863813	missense	probably damaging	0.98
R2444:Nav3	UTSW	10	109764915	missense	probably benign	0.09
R3026:Nav3	UTSW	10	109824604	missense	probably damaging	0.99
R3052:Nav3	UTSW	10	109903752	missense	probably damaging	0.99
R3441:Nav3	UTSW	10	109704928	missense	probably benign	0.01
R3845:Nav3	UTSW	10	109853376	missense	possibly damaging	0.82
R3929:Nav3	UTSW	10	109684203	missense	probably damaging	1.00
R3932:Nav3	UTSW	10	109694035	missense	probably damaging	0.99
R4056:Nav3	UTSW	10	109880533	critical splice donor site	probably null
R4057:Nav3	UTSW	10	109880533	critical splice donor site	probably null
R4120:Nav3	UTSW	10	109903744	critical splice donor site	probably null
R4244:Nav3	UTSW	10	109769296	missense	probably damaging	1.00
R4361:Nav3	UTSW	10	109852986	missense	probably damaging	1.00
R4512:Nav3	UTSW	10	109694082	missense	possibly damaging	0.89
R4514:Nav3	UTSW	10	109694082	missense	possibly damaging	0.89
R4700:Nav3	UTSW	10	109764935	missense	probably benign	0.10
R4981:Nav3	UTSW	10	109880692	missense	probably benign
R5042:Nav3	UTSW	10	109769268	missense	probably benign	0.27
R5251:Nav3	UTSW	10	109853253	missense	probably damaging	0.99
R5252:Nav3	UTSW	10	109714291	small deletion	probably benign
R5273:Nav3	UTSW	10	109693038	critical splice donor site	probably null
R5288:Nav3	UTSW	10	109853105	missense	probably benign	0.10
R5407:Nav3	UTSW	10	109866935	missense	probably benign	0.28
R5533:Nav3	UTSW	10	109883678	missense	possibly damaging	0.61
R5561:Nav3	UTSW	10	109716552	missense	probably damaging	1.00
R5577:Nav3	UTSW	10	109769403	missense	probably damaging	1.00
R5656:Nav3	UTSW	10	109764633	missense	probably damaging	0.96
R5872:Nav3	UTSW	10	109764787	missense	probably damaging	1.00
R6023:Nav3	UTSW	10	109823515	missense	possibly damaging	0.95
R6061:Nav3	UTSW	10	109866984	nonsense	probably null
R6189:Nav3	UTSW	10	109720019	missense	probably damaging	0.98
R6214:Nav3	UTSW	10	109852565	missense	probably damaging	1.00
R6215:Nav3	UTSW	10	109852565	missense	probably damaging	1.00
R6264:Nav3	UTSW	10	109688833	missense	probably damaging	0.97
R6500:Nav3	UTSW	10	109764756	missense	probably damaging	1.00
R6524:Nav3	UTSW	10	109720030	missense	probably damaging	0.99
R6868:Nav3	UTSW	10	109693166	missense	possibly damaging	0.49
R7079:Nav3	UTSW	10	109767292	missense	probably benign	0.16
R7099:Nav3	UTSW	10	109703334	missense	probably benign	0.11
R7139:Nav3	UTSW	10	109853477	missense	probably benign	0.44
R7238:Nav3	UTSW	10	109853324	missense	possibly damaging	0.75
R7338:Nav3	UTSW	10	109769212	missense	probably benign	0.04
R7343:Nav3	UTSW	10	109903758	missense	probably damaging	0.98
R7383:Nav3	UTSW	10	109716671	missense	probably damaging	0.98
R7391:Nav3	UTSW	10	109703456	missense	probably benign	0.07
R7399:Nav3	UTSW	10	109852934	missense	possibly damaging	0.74
R7457:Nav3	UTSW	10	109696328	nonsense	probably null
R7462:Nav3	UTSW	10	109823578	missense	probably damaging	1.00
R7542:Nav3	UTSW	10	109823533	missense	possibly damaging	0.89
R7659:Nav3	UTSW	10	109766990	missense	probably benign	0.09
R7749:Nav3	UTSW	10	109703352	missense	probably damaging	0.99
R7794:Nav3	UTSW	10	109688856	missense	probably benign	0.08
X0012:Nav3	UTSW	10	109692097	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACACATCCAGGTCACTGCTTG -3'
(R):5'- TGAGCTTCTAGCCACACATG -3'

Sequencing Primer
(F):5'- ATGTTTCCCAGACGCGAGACAG -3'
(R):5'- ACATGCAACTCAAGTTTTTCCTGTGG -3'

Posted On

2016-02-04