Mutagenetix > Incidental Mutation

Incidental Mutation 'R4815:Alpk2'

369750

Institutional Source

Beutler Lab

Gene Symbol

Alpk2

Ensembl Gene

ENSMUSG00000032845

Gene Name

alpha-kinase 2

Synonyms

Hak

MMRRC Submission

042433-MU

Accession Numbers

Genbank: NM_001037294

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4815 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

65265529-65393888 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 65349955 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 327 (N327K)

Ref Sequence

ENSEMBL: ENSMUSP00000048752 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035548] [ENSMUST00000141250]

AlphaFold

Q91ZB0

Predicted Effect

probably damaging
Transcript: ENSMUST00000035548
AA Change: N327K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000048752
Gene: ENSMUSG00000032845
AA Change: N327K

Domain	Start	End	E-Value	Type
IGc2	24	94	9.34e-4	SMART
low complexity region	196	209	N/A	INTRINSIC
low complexity region	722	734	N/A	INTRINSIC
low complexity region	1025	1037	N/A	INTRINSIC
low complexity region	1337	1353	N/A	INTRINSIC
IG	1766	1849	2.27e-2	SMART
Alpha_kinase	1879	2098	3.72e-79	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000141250

SMART Domains

Protein: ENSMUSP00000114658
Gene: ENSMUSG00000032845

Domain	Start	End	E-Value	Type
low complexity region	255	267	N/A	INTRINSIC
low complexity region	558	570	N/A	INTRINSIC
low complexity region	870	886	N/A	INTRINSIC
IG	1299	1382	2.27e-2	SMART
Alpha_kinase	1412	1603	2.45e-56	SMART

Meta Mutation Damage Score

0.1083

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.5%

Validation Efficiency

96% (76/79)

Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ank2	T	C	3: 126,936,761	T675A	probably benign	Het
Arap3	T	C	18: 37,973,243	T1516A	probably benign	Het
Asb18	A	T	1: 90,014,425	N51K	probably damaging	Het
BC003331	A	G	1: 150,374,846	C294R	probably damaging	Het
C7	A	G	15: 5,059,405	V18A	probably benign	Het
Caap1	A	G	4: 94,501,260	V279A	probably benign	Het
Cacnb2	A	G	2: 14,874,780	D21G	probably damaging	Het
Ccdc171	T	C	4: 83,795,221	S1166P	probably damaging	Het
Chgb	A	T	2: 132,793,299	H387L	probably benign	Het
Chp2	G	A	7: 122,220,900	R91Q	probably damaging	Het
Chuk	C	A	19: 44,077,247	G703*	probably null	Het
Clmn	T	C	12: 104,785,566	D210G	probably damaging	Het
Cyp4f18	A	G	8: 71,995,995	V270A	possibly damaging	Het
Dgcr2	A	G	16: 17,858,619		probably benign	Het
Diaph1	A	T	18: 37,895,203	V411D	unknown	Het
Dkk2	C	T	3: 132,173,785	A75V	probably benign	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Dnase2a	T	C	8: 84,909,877	V187A	probably benign	Het
Dusp19	A	G	2: 80,630,945	M193V	probably benign	Het
Ear-ps2	G	A	14: 44,047,060		noncoding transcript	Het
Gm37596	C	T	3: 93,692,286	V259M	probably benign	Het
Golgb1	A	T	16: 36,913,115	Q908L	possibly damaging	Het
Hsp90aa1	T	C	12: 110,695,226	M119V	possibly damaging	Het
Ice2	C	T	9: 69,407,118	R50C	probably damaging	Het
Ifi208	A	T	1: 173,682,837	E186V	probably damaging	Het
Ift122	A	G	6: 115,881,556	K166E	possibly damaging	Het
Jcad	T	A	18: 4,675,223	L995Q	possibly damaging	Het
Kcnc4	A	T	3: 107,458,266	C209S	probably benign	Het
Kmt2a	G	A	9: 44,821,256		probably benign	Het
Lrriq1	T	A	10: 103,144,878	L1465F	probably benign	Het
Map3k7	C	A	4: 31,988,592	T247N	probably damaging	Het
Mctp2	T	G	7: 72,259,349	Q72P	possibly damaging	Het
Miga1	T	C	3: 152,290,806	Y335C	probably benign	Het
Ms4a14	A	T	19: 11,314,277	N19K	probably benign	Het
Mylk	G	A	16: 34,894,925	R541Q	probably damaging	Het
Nav3	T	C	10: 109,823,552	T735A	probably benign	Het
Nlgn1	T	A	3: 25,436,030	H511L	probably damaging	Het
Nlrp4a	A	T	7: 26,450,808	E613D	probably benign	Het
Nuf2	A	G	1: 169,510,468	S247P	probably damaging	Het
Ocstamp	A	G	2: 165,398,182	V28A	probably benign	Het
Odf2	A	C	2: 29,902,240	E155D	possibly damaging	Het
Olfr285	T	C	15: 98,312,680	N290S	probably damaging	Het
Olfr695	G	A	7: 106,874,237	P3S	probably benign	Het
Otud7a	T	C	7: 63,729,910		probably null	Het
Pacsin2	A	T	15: 83,385,059	D11E	probably damaging	Het
Pcdhga5	G	A	18: 37,695,194	V232I	probably damaging	Het
Plcb3	A	G	19: 6,962,984	I439T	possibly damaging	Het
Rag1	A	G	2: 101,643,516	V427A	probably damaging	Het
Ranbp10	A	T	8: 105,826,125	C128*	probably null	Het
Rbm8a2	A	G	1: 175,978,458	V151A	probably damaging	Het
S100pbp	A	G	4: 129,150,933		probably benign	Het
Serpinb5	G	T	1: 106,872,339	L86F	probably damaging	Het
Sgo2b	T	C	8: 63,931,414	I183V	probably benign	Het
Slc25a25	A	T	2: 32,420,410	D112E	probably damaging	Het
Slc30a5	C	T	13: 100,813,710	V103I	probably damaging	Het
Slc9a2	A	T	1: 40,718,849	I183F	probably benign	Het
Srrm4	T	A	5: 116,475,190	K141N	unknown	Het
Tbc1d20	T	C	2: 152,311,989		probably benign	Het
Tep1	A	G	14: 50,841,302	L1498P	probably damaging	Het
Tgfbi	T	C	13: 56,632,120	M494T	probably benign	Het
Tox	A	G	4: 6,823,033	S95P	probably benign	Het
Tpr	G	A	1: 150,398,608	V163I	probably benign	Het
Trpm7	A	G	2: 126,858,492	S2P	probably damaging	Het
Ttn	A	G	2: 76,716,085	M32328T	probably damaging	Het
Vps39	A	T	2: 120,338,559	N289K	probably benign	Het
Xdh	C	T	17: 73,906,215	A847T	probably damaging	Het
Xndc1	G	A	7: 102,073,316	G63R	probably null	Het
Ythdc2	A	G	18: 44,885,240	S1330G	probably benign	Het
Zc3h14	C	G	12: 98,752,848	D157E	probably damaging	Het
Zc3h7b	A	T	15: 81,793,663	K949N	probably damaging	Het
Zp3r	A	T	1: 130,598,912	Y185N	probably damaging	Het

Other mutations in Alpk2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00468:Alpk2	APN	18	65305823	missense	probably benign	0.27
IGL00478:Alpk2	APN	18	65307226	nonsense	probably null
IGL00898:Alpk2	APN	18	65350573	missense	probably benign	0.29
IGL00978:Alpk2	APN	18	65291534	splice site	probably benign
IGL01093:Alpk2	APN	18	65349329	missense	probably damaging	0.98
IGL01094:Alpk2	APN	18	65306602	missense	probably damaging	0.96
IGL01109:Alpk2	APN	18	65307140	missense	probably benign	0.09
IGL01370:Alpk2	APN	18	65350591	missense	possibly damaging	0.56
IGL01393:Alpk2	APN	18	65307708	missense	possibly damaging	0.88
IGL01629:Alpk2	APN	18	65300042	missense	probably damaging	1.00
IGL01872:Alpk2	APN	18	65304753	missense	probably benign	0.01
IGL01983:Alpk2	APN	18	65350682	missense	probably damaging	1.00
IGL02294:Alpk2	APN	18	65306075	missense	possibly damaging	0.45
IGL02333:Alpk2	APN	18	65349480	missense	probably damaging	0.99
IGL02493:Alpk2	APN	18	65350331	missense	probably benign	0.02
IGL02551:Alpk2	APN	18	65372751	missense	probably damaging	1.00
IGL02864:Alpk2	APN	18	65307599	missense	probably benign	0.12
IGL02901:Alpk2	APN	18	65306411	missense	probably benign
IGL02954:Alpk2	APN	18	65306136	missense	probably benign
IGL03257:Alpk2	APN	18	65349874	missense	probably damaging	0.99
IGL03389:Alpk2	APN	18	65304866	missense	possibly damaging	0.92
3-1:Alpk2	UTSW	18	65304888	missense	probably damaging	0.99
PIT4131001:Alpk2	UTSW	18	65306379	missense	possibly damaging	0.84
R0098:Alpk2	UTSW	18	65349911	missense	probably damaging	1.00
R0098:Alpk2	UTSW	18	65349911	missense	probably damaging	1.00
R0414:Alpk2	UTSW	18	65306159	missense	probably benign	0.04
R0546:Alpk2	UTSW	18	65306717	missense	probably benign	0.05
R0628:Alpk2	UTSW	18	65307296	missense	possibly damaging	0.94
R0658:Alpk2	UTSW	18	65349487	missense	probably damaging	1.00
R0731:Alpk2	UTSW	18	65305390	missense	probably damaging	0.98
R0919:Alpk2	UTSW	18	65307473	missense	probably benign
R1069:Alpk2	UTSW	18	65305014	missense	probably benign	0.25
R1186:Alpk2	UTSW	18	65294341	critical splice acceptor site	probably null
R1508:Alpk2	UTSW	18	65349305	missense	probably damaging	1.00
R1535:Alpk2	UTSW	18	65350204	missense	probably benign
R1558:Alpk2	UTSW	18	65350230	missense	probably benign
R1600:Alpk2	UTSW	18	65378037	missense	probably damaging	0.96
R1664:Alpk2	UTSW	18	65349873	missense	probably damaging	0.96
R1672:Alpk2	UTSW	18	65280959	missense	probably damaging	1.00
R1829:Alpk2	UTSW	18	65294094	missense	possibly damaging	0.75
R2110:Alpk2	UTSW	18	65307080	missense	possibly damaging	0.94
R2111:Alpk2	UTSW	18	65349774	missense	probably benign
R2113:Alpk2	UTSW	18	65305683	missense	probably benign	0.31
R2126:Alpk2	UTSW	18	65350368	nonsense	probably null
R2198:Alpk2	UTSW	18	65350184	missense	probably benign	0.42
R2227:Alpk2	UTSW	18	65378076	missense	probably damaging	1.00
R2245:Alpk2	UTSW	18	65305163	missense	probably benign	0.02
R2282:Alpk2	UTSW	18	65307626	missense	probably benign
R2421:Alpk2	UTSW	18	65306616	missense	probably benign	0.00
R2512:Alpk2	UTSW	18	65350520	missense	probably damaging	0.96
R3105:Alpk2	UTSW	18	65350210	missense	possibly damaging	0.57
R3700:Alpk2	UTSW	18	65305151	missense	probably damaging	0.99
R4205:Alpk2	UTSW	18	65305211	missense	possibly damaging	0.76
R4239:Alpk2	UTSW	18	65300141	missense	probably damaging	1.00
R4353:Alpk2	UTSW	18	65291452	missense	possibly damaging	0.73
R4572:Alpk2	UTSW	18	65281004	missense	probably damaging	1.00
R4584:Alpk2	UTSW	18	65306964	missense	probably damaging	0.99
R4591:Alpk2	UTSW	18	65305823	missense	probably benign	0.27
R4595:Alpk2	UTSW	18	65289748	missense	probably damaging	1.00
R4648:Alpk2	UTSW	18	65349882	missense	probably damaging	0.99
R4828:Alpk2	UTSW	18	65349113	missense	probably benign
R4910:Alpk2	UTSW	18	65266286	nonsense	probably null
R5042:Alpk2	UTSW	18	65350508	nonsense	probably null
R5295:Alpk2	UTSW	18	65305038	missense	probably damaging	0.98
R5375:Alpk2	UTSW	18	65372738	missense	probably damaging	1.00
R5475:Alpk2	UTSW	18	65307012	missense	probably benign	0.16
R5480:Alpk2	UTSW	18	65349908	missense	probably damaging	1.00
R5486:Alpk2	UTSW	18	65294354	splice site	probably null
R5503:Alpk2	UTSW	18	65306241	missense	probably benign	0.00
R5595:Alpk2	UTSW	18	65266248	missense	probably damaging	1.00
R5648:Alpk2	UTSW	18	65349917	missense	probably damaging	0.96
R5714:Alpk2	UTSW	18	65305461	missense	possibly damaging	0.55
R5862:Alpk2	UTSW	18	65307289	missense	probably damaging	1.00
R5894:Alpk2	UTSW	18	65281072	missense	probably damaging	0.99
R5898:Alpk2	UTSW	18	65307623	missense	probably damaging	0.99
R5936:Alpk2	UTSW	18	65350520	missense	probably damaging	0.96
R6142:Alpk2	UTSW	18	65305385	missense	possibly damaging	0.94
R6291:Alpk2	UTSW	18	65305901	missense	possibly damaging	0.93
R6339:Alpk2	UTSW	18	65349806	missense	probably benign	0.00
R6407:Alpk2	UTSW	18	65289738	missense	probably benign	0.22
R6487:Alpk2	UTSW	18	65266183	missense	possibly damaging	0.62
R6667:Alpk2	UTSW	18	65307740	missense	probably damaging	1.00
R6786:Alpk2	UTSW	18	65306634	missense	probably benign
R6833:Alpk2	UTSW	18	65306409	missense	probably benign	0.08
R6984:Alpk2	UTSW	18	65305678	missense	possibly damaging	0.95
R6999:Alpk2	UTSW	18	65304513	missense	probably damaging	0.99
R7157:Alpk2	UTSW	18	65266277	nonsense	probably null
R7167:Alpk2	UTSW	18	65306978	missense	probably benign	0.40
R7225:Alpk2	UTSW	18	65305199	missense	probably benign	0.00
R7409:Alpk2	UTSW	18	65306952	missense	probably benign	0.01
R7533:Alpk2	UTSW	18	65304603	missense	probably damaging	1.00
R7576:Alpk2	UTSW	18	65306816	missense	possibly damaging	0.89
R7589:Alpk2	UTSW	18	65300073	missense	probably damaging	1.00
R7598:Alpk2	UTSW	18	65304566	missense	probably damaging	1.00
R7664:Alpk2	UTSW	18	65307002	missense	probably benign	0.03
R7711:Alpk2	UTSW	18	65306484	missense	probably benign
R7722:Alpk2	UTSW	18	65350157	missense	probably damaging	1.00
R7783:Alpk2	UTSW	18	65306254	nonsense	probably null
R7806:Alpk2	UTSW	18	65349416	missense	probably benign
R7953:Alpk2	UTSW	18	65349830	missense	probably damaging	1.00
R8024:Alpk2	UTSW	18	65305035	missense	probably benign	0.01
R8043:Alpk2	UTSW	18	65349830	missense	probably damaging	1.00
R8063:Alpk2	UTSW	18	65350346	missense	probably benign	0.15
R8171:Alpk2	UTSW	18	65305983	missense	probably benign	0.00
R8280:Alpk2	UTSW	18	65307203	missense	probably benign
R8383:Alpk2	UTSW	18	65305398	missense	probably benign	0.03
R8414:Alpk2	UTSW	18	65307471	missense	possibly damaging	0.89
R8791:Alpk2	UTSW	18	65305526	missense	probably benign	0.00
R8872:Alpk2	UTSW	18	65280906	missense	probably damaging	1.00
R9352:Alpk2	UTSW	18	65306712	missense	probably benign	0.01
R9449:Alpk2	UTSW	18	65291393	missense	probably damaging	1.00
R9525:Alpk2	UTSW	18	65266217	missense	probably damaging	1.00
R9564:Alpk2	UTSW	18	65305943	missense	probably damaging	1.00
R9710:Alpk2	UTSW	18	65349575	missense	probably damaging	1.00
X0023:Alpk2	UTSW	18	65291400	missense	probably damaging	1.00
X0027:Alpk2	UTSW	18	65307471	missense	possibly damaging	0.89
X0063:Alpk2	UTSW	18	65307363	missense	probably benign
X0064:Alpk2	UTSW	18	65349684	missense	probably benign	0.09
Z1176:Alpk2	UTSW	18	65305611	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- GGTTGTGAGTGATAACTACAGAAGC -3'
(R):5'- TTCCATTGCCGGAGACAACC -3'

Sequencing Primer
(F):5'- TGATAACTACAGAAGCCAGTGG -3'
(R):5'- GAGACAACCCTGGGTCCTTAC -3'

Posted On

2016-02-04