Incidental Mutation 'R4815:Alpk2'
ID369750
Institutional Source Beutler Lab
Gene Symbol Alpk2
Ensembl Gene ENSMUSG00000032845
Gene Namealpha-kinase 2
SynonymsHak
MMRRC Submission 042433-MU
Accession Numbers

Genbank: NM_001037294

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4815 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location65265529-65393888 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 65349955 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 327 (N327K)
Ref Sequence ENSEMBL: ENSMUSP00000048752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035548] [ENSMUST00000141250]
Predicted Effect probably damaging
Transcript: ENSMUST00000035548
AA Change: N327K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048752
Gene: ENSMUSG00000032845
AA Change: N327K

DomainStartEndE-ValueType
IGc2 24 94 9.34e-4 SMART
low complexity region 196 209 N/A INTRINSIC
low complexity region 722 734 N/A INTRINSIC
low complexity region 1025 1037 N/A INTRINSIC
low complexity region 1337 1353 N/A INTRINSIC
IG 1766 1849 2.27e-2 SMART
Alpha_kinase 1879 2098 3.72e-79 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000141250
SMART Domains Protein: ENSMUSP00000114658
Gene: ENSMUSG00000032845

DomainStartEndE-ValueType
low complexity region 255 267 N/A INTRINSIC
low complexity region 558 570 N/A INTRINSIC
low complexity region 870 886 N/A INTRINSIC
IG 1299 1382 2.27e-2 SMART
Alpha_kinase 1412 1603 2.45e-56 SMART
Meta Mutation Damage Score 0.1083 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 96% (76/79)
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank2 T C 3: 126,936,761 T675A probably benign Het
Arap3 T C 18: 37,973,243 T1516A probably benign Het
Asb18 A T 1: 90,014,425 N51K probably damaging Het
BC003331 A G 1: 150,374,846 C294R probably damaging Het
C7 A G 15: 5,059,405 V18A probably benign Het
Caap1 A G 4: 94,501,260 V279A probably benign Het
Cacnb2 A G 2: 14,874,780 D21G probably damaging Het
Ccdc171 T C 4: 83,795,221 S1166P probably damaging Het
Chgb A T 2: 132,793,299 H387L probably benign Het
Chp2 G A 7: 122,220,900 R91Q probably damaging Het
Chuk C A 19: 44,077,247 G703* probably null Het
Clmn T C 12: 104,785,566 D210G probably damaging Het
Cyp4f18 A G 8: 71,995,995 V270A possibly damaging Het
Dgcr2 A G 16: 17,858,619 probably benign Het
Diaph1 A T 18: 37,895,203 V411D unknown Het
Dkk2 C T 3: 132,173,785 A75V probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dnase2a T C 8: 84,909,877 V187A probably benign Het
Dusp19 A G 2: 80,630,945 M193V probably benign Het
Ear-ps2 G A 14: 44,047,060 noncoding transcript Het
Gm37596 C T 3: 93,692,286 V259M probably benign Het
Golgb1 A T 16: 36,913,115 Q908L possibly damaging Het
Hsp90aa1 T C 12: 110,695,226 M119V possibly damaging Het
Ice2 C T 9: 69,407,118 R50C probably damaging Het
Ifi208 A T 1: 173,682,837 E186V probably damaging Het
Ift122 A G 6: 115,881,556 K166E possibly damaging Het
Jcad T A 18: 4,675,223 L995Q possibly damaging Het
Kcnc4 A T 3: 107,458,266 C209S probably benign Het
Kmt2a G A 9: 44,821,256 probably benign Het
Lrriq1 T A 10: 103,144,878 L1465F probably benign Het
Map3k7 C A 4: 31,988,592 T247N probably damaging Het
Mctp2 T G 7: 72,259,349 Q72P possibly damaging Het
Miga1 T C 3: 152,290,806 Y335C probably benign Het
Ms4a14 A T 19: 11,314,277 N19K probably benign Het
Mylk G A 16: 34,894,925 R541Q probably damaging Het
Nav3 T C 10: 109,823,552 T735A probably benign Het
Nlgn1 T A 3: 25,436,030 H511L probably damaging Het
Nlrp4a A T 7: 26,450,808 E613D probably benign Het
Nuf2 A G 1: 169,510,468 S247P probably damaging Het
Ocstamp A G 2: 165,398,182 V28A probably benign Het
Odf2 A C 2: 29,902,240 E155D possibly damaging Het
Olfr285 T C 15: 98,312,680 N290S probably damaging Het
Olfr695 G A 7: 106,874,237 P3S probably benign Het
Otud7a T C 7: 63,729,910 probably null Het
Pacsin2 A T 15: 83,385,059 D11E probably damaging Het
Pcdhga5 G A 18: 37,695,194 V232I probably damaging Het
Plcb3 A G 19: 6,962,984 I439T possibly damaging Het
Rag1 A G 2: 101,643,516 V427A probably damaging Het
Ranbp10 A T 8: 105,826,125 C128* probably null Het
Rbm8a2 A G 1: 175,978,458 V151A probably damaging Het
S100pbp A G 4: 129,150,933 probably benign Het
Serpinb5 G T 1: 106,872,339 L86F probably damaging Het
Sgo2b T C 8: 63,931,414 I183V probably benign Het
Slc25a25 A T 2: 32,420,410 D112E probably damaging Het
Slc30a5 C T 13: 100,813,710 V103I probably damaging Het
Slc9a2 A T 1: 40,718,849 I183F probably benign Het
Srrm4 T A 5: 116,475,190 K141N unknown Het
Tbc1d20 T C 2: 152,311,989 probably benign Het
Tep1 A G 14: 50,841,302 L1498P probably damaging Het
Tgfbi T C 13: 56,632,120 M494T probably benign Het
Tox A G 4: 6,823,033 S95P probably benign Het
Tpr G A 1: 150,398,608 V163I probably benign Het
Trpm7 A G 2: 126,858,492 S2P probably damaging Het
Ttn A G 2: 76,716,085 M32328T probably damaging Het
Vps39 A T 2: 120,338,559 N289K probably benign Het
Xdh C T 17: 73,906,215 A847T probably damaging Het
Xndc1 G A 7: 102,073,316 G63R probably null Het
Ythdc2 A G 18: 44,885,240 S1330G probably benign Het
Zc3h14 C G 12: 98,752,848 D157E probably damaging Het
Zc3h7b A T 15: 81,793,663 K949N probably damaging Het
Zp3r A T 1: 130,598,912 Y185N probably damaging Het
Other mutations in Alpk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Alpk2 APN 18 65305823 missense probably benign 0.27
IGL00478:Alpk2 APN 18 65307226 nonsense probably null
IGL00898:Alpk2 APN 18 65350573 missense probably benign 0.29
IGL00978:Alpk2 APN 18 65291534 splice site probably benign
IGL01093:Alpk2 APN 18 65349329 missense probably damaging 0.98
IGL01094:Alpk2 APN 18 65306602 missense probably damaging 0.96
IGL01109:Alpk2 APN 18 65307140 missense probably benign 0.09
IGL01370:Alpk2 APN 18 65350591 missense possibly damaging 0.56
IGL01393:Alpk2 APN 18 65307708 missense possibly damaging 0.88
IGL01629:Alpk2 APN 18 65300042 missense probably damaging 1.00
IGL01872:Alpk2 APN 18 65304753 missense probably benign 0.01
IGL01983:Alpk2 APN 18 65350682 missense probably damaging 1.00
IGL02294:Alpk2 APN 18 65306075 missense possibly damaging 0.45
IGL02333:Alpk2 APN 18 65349480 missense probably damaging 0.99
IGL02493:Alpk2 APN 18 65350331 missense probably benign 0.02
IGL02551:Alpk2 APN 18 65372751 missense probably damaging 1.00
IGL02864:Alpk2 APN 18 65307599 missense probably benign 0.12
IGL02901:Alpk2 APN 18 65306411 missense probably benign
IGL02954:Alpk2 APN 18 65306136 missense probably benign
IGL03257:Alpk2 APN 18 65349874 missense probably damaging 0.99
IGL03389:Alpk2 APN 18 65304866 missense possibly damaging 0.92
3-1:Alpk2 UTSW 18 65304888 missense probably damaging 0.99
PIT4131001:Alpk2 UTSW 18 65306379 missense possibly damaging 0.84
R0098:Alpk2 UTSW 18 65349911 missense probably damaging 1.00
R0098:Alpk2 UTSW 18 65349911 missense probably damaging 1.00
R0414:Alpk2 UTSW 18 65306159 missense probably benign 0.04
R0546:Alpk2 UTSW 18 65306717 missense probably benign 0.05
R0628:Alpk2 UTSW 18 65307296 missense possibly damaging 0.94
R0658:Alpk2 UTSW 18 65349487 missense probably damaging 1.00
R0731:Alpk2 UTSW 18 65305390 missense probably damaging 0.98
R0919:Alpk2 UTSW 18 65307473 missense probably benign
R1069:Alpk2 UTSW 18 65305014 missense probably benign 0.25
R1186:Alpk2 UTSW 18 65294341 critical splice acceptor site probably null
R1508:Alpk2 UTSW 18 65349305 missense probably damaging 1.00
R1535:Alpk2 UTSW 18 65350204 missense probably benign
R1558:Alpk2 UTSW 18 65350230 missense probably benign
R1600:Alpk2 UTSW 18 65378037 missense probably damaging 0.96
R1664:Alpk2 UTSW 18 65349873 missense probably damaging 0.96
R1672:Alpk2 UTSW 18 65280959 missense probably damaging 1.00
R1829:Alpk2 UTSW 18 65294094 missense possibly damaging 0.75
R2110:Alpk2 UTSW 18 65307080 missense possibly damaging 0.94
R2111:Alpk2 UTSW 18 65349774 missense probably benign
R2113:Alpk2 UTSW 18 65305683 missense probably benign 0.31
R2126:Alpk2 UTSW 18 65350368 nonsense probably null
R2198:Alpk2 UTSW 18 65350184 missense probably benign 0.42
R2227:Alpk2 UTSW 18 65378076 missense probably damaging 1.00
R2245:Alpk2 UTSW 18 65305163 missense probably benign 0.02
R2282:Alpk2 UTSW 18 65307626 missense probably benign
R2421:Alpk2 UTSW 18 65306616 missense probably benign 0.00
R2512:Alpk2 UTSW 18 65350520 missense probably damaging 0.96
R3105:Alpk2 UTSW 18 65350210 missense possibly damaging 0.57
R3700:Alpk2 UTSW 18 65305151 missense probably damaging 0.99
R4205:Alpk2 UTSW 18 65305211 missense possibly damaging 0.76
R4239:Alpk2 UTSW 18 65300141 missense probably damaging 1.00
R4353:Alpk2 UTSW 18 65291452 missense possibly damaging 0.73
R4572:Alpk2 UTSW 18 65281004 missense probably damaging 1.00
R4584:Alpk2 UTSW 18 65306964 missense probably damaging 0.99
R4591:Alpk2 UTSW 18 65305823 missense probably benign 0.27
R4595:Alpk2 UTSW 18 65289748 missense probably damaging 1.00
R4648:Alpk2 UTSW 18 65349882 missense probably damaging 0.99
R4828:Alpk2 UTSW 18 65349113 missense probably benign
R4910:Alpk2 UTSW 18 65266286 nonsense probably null
R5042:Alpk2 UTSW 18 65350508 nonsense probably null
R5295:Alpk2 UTSW 18 65305038 missense probably damaging 0.98
R5375:Alpk2 UTSW 18 65372738 missense probably damaging 1.00
R5475:Alpk2 UTSW 18 65307012 missense probably benign 0.16
R5480:Alpk2 UTSW 18 65349908 missense probably damaging 1.00
R5486:Alpk2 UTSW 18 65294354 splice site probably null
R5503:Alpk2 UTSW 18 65306241 missense probably benign 0.00
R5595:Alpk2 UTSW 18 65266248 missense probably damaging 1.00
R5648:Alpk2 UTSW 18 65349917 missense probably damaging 0.96
R5714:Alpk2 UTSW 18 65305461 missense possibly damaging 0.55
R5862:Alpk2 UTSW 18 65307289 missense probably damaging 1.00
R5894:Alpk2 UTSW 18 65281072 missense probably damaging 0.99
R5898:Alpk2 UTSW 18 65307623 missense probably damaging 0.99
R5936:Alpk2 UTSW 18 65350520 missense probably damaging 0.96
R6142:Alpk2 UTSW 18 65305385 missense possibly damaging 0.94
R6291:Alpk2 UTSW 18 65305901 missense possibly damaging 0.93
R6339:Alpk2 UTSW 18 65349806 missense probably benign 0.00
R6407:Alpk2 UTSW 18 65289738 missense probably benign 0.22
R6487:Alpk2 UTSW 18 65266183 missense possibly damaging 0.62
R6667:Alpk2 UTSW 18 65307740 missense probably damaging 1.00
R6786:Alpk2 UTSW 18 65306634 missense probably benign
R6833:Alpk2 UTSW 18 65306409 missense probably benign 0.08
R6984:Alpk2 UTSW 18 65305678 missense possibly damaging 0.95
R6999:Alpk2 UTSW 18 65304513 missense probably damaging 0.99
R7157:Alpk2 UTSW 18 65266277 nonsense probably null
R7167:Alpk2 UTSW 18 65306978 missense probably benign 0.40
R7225:Alpk2 UTSW 18 65305199 missense probably benign 0.00
R7409:Alpk2 UTSW 18 65306952 missense probably benign 0.01
R7533:Alpk2 UTSW 18 65304603 missense probably damaging 1.00
R7576:Alpk2 UTSW 18 65306816 missense possibly damaging 0.89
R7589:Alpk2 UTSW 18 65300073 missense probably damaging 1.00
R7598:Alpk2 UTSW 18 65304566 missense probably damaging 1.00
R7664:Alpk2 UTSW 18 65307002 missense probably benign 0.03
R7711:Alpk2 UTSW 18 65306484 missense probably benign
R7722:Alpk2 UTSW 18 65350157 missense probably damaging 1.00
R7783:Alpk2 UTSW 18 65306254 nonsense probably null
R7806:Alpk2 UTSW 18 65349416 missense probably benign
R8024:Alpk2 UTSW 18 65305035 missense probably benign 0.01
R8043:Alpk2 UTSW 18 65349830 missense probably damaging 1.00
R8063:Alpk2 UTSW 18 65350346 missense probably benign 0.15
X0023:Alpk2 UTSW 18 65291400 missense probably damaging 1.00
X0027:Alpk2 UTSW 18 65307471 missense possibly damaging 0.89
X0063:Alpk2 UTSW 18 65307363 missense probably benign
X0064:Alpk2 UTSW 18 65349684 missense probably benign 0.09
Z1176:Alpk2 UTSW 18 65305611 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGTTGTGAGTGATAACTACAGAAGC -3'
(R):5'- TTCCATTGCCGGAGACAACC -3'

Sequencing Primer
(F):5'- TGATAACTACAGAAGCCAGTGG -3'
(R):5'- GAGACAACCCTGGGTCCTTAC -3'
Posted On2016-02-04