Mutagenetix > Incidental Mutation

Incidental Mutation 'R4816:Cacna1s'

369760

Institutional Source

Beutler Lab

Gene Symbol

Cacna1s

Ensembl Gene

ENSMUSG00000026407

Gene Name

calcium channel, voltage-dependent, L type, alpha 1S subunit

Synonyms

sj, mdg, muscle dysgenesis, DHPR alpha1s, Cav1.1, Cchl1a3, fmd

MMRRC Submission

042434-MU

Accession Numbers

Genbank: NM_001081023; MGI: 88294

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4816 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

136052750-136119822 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 136115269 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Lysine at position 1331 (I1331K)

Ref Sequence

ENSEMBL: ENSMUSP00000125262 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000112064] [ENSMUST00000112068] [ENSMUST00000160641] [ENSMUST00000161865]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000112064
AA Change: I1597K

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000107695
Gene: ENSMUSG00000026407
AA Change: I1597K

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	50	345	4.3e-68	PFAM
Pfam:Ion_trans	431	672	4.5e-56	PFAM
Pfam:PKD_channel	516	667	1.9e-7	PFAM
low complexity region	675	685	N/A	INTRINSIC
low complexity region	740	756	N/A	INTRINSIC
Pfam:Ion_trans	798	1076	2.6e-65	PFAM
Pfam:Ion_trans	1117	1392	1.2e-71	PFAM
Pfam:PKD_channel	1126	1387	8.4e-13	PFAM
Pfam:GPHH	1394	1463	2.3e-38	PFAM
Ca_chan_IQ	1515	1548	3.71e-14	SMART
low complexity region	1657	1669	N/A	INTRINSIC
Pfam:CAC1F_C	1756	1845	2.8e-8	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000112068
AA Change: I1578K

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000107699
Gene: ENSMUSG00000026407
AA Change: I1578K

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	88	333	9.1e-57	PFAM
PDB:4DEY\|B	334	417	1e-20	PDB
Pfam:Ion_trans	466	660	3.7e-46	PFAM
Pfam:PKD_channel	513	667	6.7e-7	PFAM
low complexity region	675	685	N/A	INTRINSIC
low complexity region	740	756	N/A	INTRINSIC
low complexity region	804	818	N/A	INTRINSIC
Pfam:Ion_trans	834	1064	3.9e-53	PFAM
Pfam:Ion_trans	1152	1361	6.7e-66	PFAM
Pfam:PKD_channel	1201	1368	8.4e-10	PFAM
Blast:EFh	1382	1410	5e-8	BLAST
Ca_chan_IQ	1496	1529	3.71e-14	SMART
low complexity region	1638	1650	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159106

Predicted Effect

possibly damaging
Transcript: ENSMUST00000160641
AA Change: I1597K

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000125278
Gene: ENSMUSG00000026407
AA Change: I1597K

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	88	333	9.3e-57	PFAM
PDB:4DEY\|B	334	417	1e-20	PDB
Pfam:Ion_trans	466	660	3.8e-46	PFAM
Pfam:PKD_channel	513	667	6.7e-7	PFAM
low complexity region	675	685	N/A	INTRINSIC
low complexity region	740	756	N/A	INTRINSIC
low complexity region	804	818	N/A	INTRINSIC
Pfam:Ion_trans	834	1064	4e-53	PFAM
Pfam:PKD_channel	1126	1387	6.1e-12	PFAM
Pfam:Ion_trans	1152	1380	9e-65	PFAM
Blast:EFh	1401	1429	5e-8	BLAST
Ca_chan_IQ	1515	1548	3.71e-14	SMART
low complexity region	1657	1669	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161700

Predicted Effect

possibly damaging
Transcript: ENSMUST00000161865
AA Change: I1331K

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000125262
Gene: ENSMUSG00000026407
AA Change: I1331K

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	3	98	1.1e-21	PFAM
Pfam:Ion_trans	184	425	3.3e-56	PFAM
Pfam:PKD_channel	267	420	1.8e-7	PFAM
low complexity region	428	438	N/A	INTRINSIC
low complexity region	493	509	N/A	INTRINSIC
Pfam:Ion_trans	551	829	1.9e-65	PFAM
Pfam:Ion_trans	870	1126	5.4e-72	PFAM
Pfam:PKD_channel	954	1121	7.2e-10	PFAM
Pfam:GPHH	1128	1197	1.8e-38	PFAM
Ca_chan_IQ	1249	1282	3.71e-14	SMART
low complexity region	1391	1403	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194155

Meta Mutation Damage Score

0.4670

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 93.0%

Validation Efficiency

97% (113/116)

MGI Phenotype

Strain: 1856326
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the five subunits of the slowly inactivating L-type voltage-dependent calcium channel in skeletal muscle cells. Mutations in this gene have been associated with hypokalemic periodic paralysis, thyrotoxic periodic paralysis and malignant hyperthermia susceptibility. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants show edema and failure of myoblast differentiation by day 13 of embryonic development and die perinatally. All muscles degenerate and additional secondary anomalies of the skeleton, short jaw, and cleft palate are seen. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted(3) Spontaneous(1)

Other mutations in this stock

Total: 107 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	C	11: 23,615,243	I248S	possibly damaging	Het
8030462N17Rik	A	T	18: 77,653,299		probably null	Het
Abcc8	C	A	7: 46,104,707	A1562S	probably benign	Het
Adam30	C	A	3: 98,162,745	D631E	possibly damaging	Het
Adgrv1	T	C	13: 81,528,674	T2013A	probably damaging	Het
Als2cr12	G	A	1: 58,670,408	A196V	probably benign	Het
Baiap3	T	A	17: 25,247,295		probably benign	Het
Bicra	T	C	7: 15,988,906	T229A	possibly damaging	Het
C1qbp	A	G	11: 70,982,364		probably benign	Het
C2cd3	C	A	7: 100,391,019	T265K	probably benign	Het
Cdadc1	AGACGGA	AGA	14: 59,568,991		probably null	Het
Cdcp2	A	G	4: 107,106,772	Y273C	probably damaging	Het
Cdh23	A	C	10: 60,409,077	V1013G	possibly damaging	Het
Celf3	T	A	3: 94,479,222	I39N	probably damaging	Het
Cep152	A	C	2: 125,563,754	S1619R	probably damaging	Het
Cfap36	A	G	11: 29,245,108	I42T	probably damaging	Het
Cfap61	G	T	2: 146,143,100	V955L	probably damaging	Het
Cit	G	A	5: 115,908,691	D388N	probably damaging	Het
Clca3a2	T	C	3: 144,810,852	M328V	probably benign	Het
Cntn4	A	T	6: 106,550,497	I447L	probably benign	Het
Csmd3	T	C	15: 47,857,934	T1538A	possibly damaging	Het
Cstf1	A	G	2: 172,372,985	K9E	probably damaging	Het
Dip2c	T	A	13: 9,575,150	M560K	probably benign	Het
Dsg1a	A	T	18: 20,333,722	T550S	probably benign	Het
Dtnb	A	G	12: 3,749,505	E460G	probably damaging	Het
Dus1l	GAGGTAAG	GAG	11: 120,789,758		probably benign	Het
Efl1	T	A	7: 82,671,719	V120E	probably damaging	Het
Fbxl13	T	C	5: 21,484,003	Y769C	probably benign	Het
Fcho2	T	C	13: 98,806,366	Y22C	probably damaging	Het
Gbp3	T	C	3: 142,567,574	V294A	probably damaging	Het
Gls	A	G	1: 52,199,945		probably benign	Het
Gm15130	A	T	2: 111,135,369		probably benign	Het
Gm6185	A	T	1: 161,213,158		noncoding transcript	Het
Gpr171	T	A	3: 59,098,096	H86L	probably damaging	Het
Gpr179	T	C	11: 97,339,248	T694A	probably damaging	Het
H2-Aa	A	T	17: 34,283,820	V124E	probably damaging	Het
H2-M5	A	G	17: 36,989,417		probably benign	Het
Hist1h2bl	A	G	13: 21,715,965	M60T	probably benign	Het
Igf2r	A	T	17: 12,684,097	N2355K	probably damaging	Het
Il9r	A	C	11: 32,192,654	S295A	possibly damaging	Het
Ipo9	T	C	1: 135,406,550	T313A	probably benign	Het
Kalrn	C	T	16: 34,514,019		probably benign	Het
Lama3	G	A	18: 12,477,604	V1175M	possibly damaging	Het
Lhpp	T	A	7: 132,670,375	C242*	probably null	Het
Lipe	A	G	7: 25,380,143	S1013P	probably damaging	Het
Lrrc25	C	T	8: 70,618,076	T169I	probably benign	Het
Lrrc39	T	C	3: 116,568,866		probably null	Het
Lrrd1	T	A	5: 3,851,126	L477*	probably null	Het
Lrriq4	A	G	3: 30,660,047	I515V	possibly damaging	Het
Magel2	A	G	7: 62,381,092	Y1248C	unknown	Het
Maml1	G	T	11: 50,258,335	N859K	possibly damaging	Het
Mdm1	A	T	10: 118,146,877	H139L	possibly damaging	Het
Mef2d	C	T	3: 88,168,090	P420S	possibly damaging	Het
Mgat4b	A	G	11: 50,211,021	K38E	probably benign	Het
Mtmr4	T	C	11: 87,604,097	V405A	probably damaging	Het
Naip5	G	A	13: 100,219,681	S1142F	probably benign	Het
Naip5	G	A	13: 100,219,687	T1140M	probably benign	Het
Naip5	T	C	13: 100,219,696	Q1137R	probably benign	Het
Nfe2l3	T	C	6: 51,456,624	S239P	probably damaging	Het
Nlrp3	A	G	11: 59,548,301	I235V	probably benign	Het
Nyap2	T	A	1: 81,241,313	L318Q	probably damaging	Het
Nynrin	G	A	14: 55,872,001	V1522M	probably damaging	Het
Olfr1016	A	T	2: 85,800,047	N74K	probably benign	Het
Olfr1461	A	G	19: 13,165,124	I37V	probably benign	Het
Olfr659	C	T	7: 104,670,735	P11L	probably benign	Het
Olfr810	T	C	10: 129,791,439	D50G	probably damaging	Het
Olfr875	T	A	9: 37,773,430	M257K	possibly damaging	Het
Oog3	A	G	4: 144,159,161	L289P	probably damaging	Het
Pax6	T	C	2: 105,683,784		probably benign	Het
Pbrm1	G	A	14: 31,110,448	R1441K	probably benign	Het
Pcdha9	C	T	18: 36,999,458	R527W	probably damaging	Het
Pcdhb17	T	C	18: 37,487,397	S747P	probably benign	Het
Pcnx3	A	C	19: 5,687,995		probably null	Het
Pds5a	A	T	5: 65,651,289	V413E	probably damaging	Het
Phpt1	G	T	2: 25,574,320		probably benign	Het
Phykpl	A	G	11: 51,592,953	E220G	probably benign	Het
Pias2	T	C	18: 77,105,891		probably null	Het
Pkhd1	T	A	1: 20,199,415	I3302L	probably damaging	Het
Poli	A	G	18: 70,522,751	L241P	probably damaging	Het
Ppm1h	T	A	10: 122,679,379	I65N	possibly damaging	Het
Ptpn14	T	C	1: 189,856,800	L954P	probably damaging	Het
Pxk	T	G	14: 8,136,893	M138R	probably damaging	Het
Rasl11b	G	T	5: 74,198,397	D188Y	probably damaging	Het
Rtraf	A	G	14: 19,822,576	F59S	probably benign	Het
Serpinb5	G	T	1: 106,872,339	L86F	probably damaging	Het
Setdb2	G	A	14: 59,413,646	T412I	probably benign	Het
Shank2	C	A	7: 144,052,306	N75K	probably damaging	Het
Shank3	T	A	15: 89,543,115	I791N	probably damaging	Het
Slc25a13	T	A	6: 6,114,274	M213L	possibly damaging	Het
Slc25a21	T	C	12: 56,713,838	Y298C	probably damaging	Het
Slc34a2	A	G	5: 53,069,020	N495S	probably damaging	Het
Smc2	A	G	4: 52,451,231	T292A	probably benign	Het
Spag9	T	C	11: 94,048,599		probably benign	Het
Tas2r113	C	T	6: 132,893,782	P258S	probably benign	Het
Tbkbp1	T	C	11: 97,138,741	S530G	probably benign	Het
Tenm2	A	G	11: 36,027,290	V1881A	probably damaging	Het
Tm9sf1	C	T	14: 55,641,149	R262Q	possibly damaging	Het
Tmcc3	G	T	10: 94,578,784	G147V	possibly damaging	Het
Trim38	A	T	13: 23,788,281	E195V	probably damaging	Het
Try5	T	C	6: 41,313,415	Y45C	probably benign	Het
Umad1	A	C	6: 8,457,462		probably benign	Het
Vmn2r105	T	C	17: 20,208,691	I708V	probably benign	Het
Zc3h12d	A	T	10: 7,867,947	S494C	probably damaging	Het
Zeb2	A	G	2: 44,997,768	S382P	probably damaging	Het
Zfc3h1	A	G	10: 115,415,694	S1304G	probably benign	Het
Zfp287	G	T	11: 62,714,248	T611K	probably damaging	Het
Zfp534	G	A	4: 147,674,286	T642I	possibly damaging	Het

Other mutations in Cacna1s

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Cacna1s	APN	1	136084273	nonsense	probably null
IGL00517:Cacna1s	APN	1	136087339	missense	probably damaging	1.00
IGL01316:Cacna1s	APN	1	136118964	missense	probably benign	0.01
IGL01348:Cacna1s	APN	1	136075152	missense	possibly damaging	0.95
IGL01739:Cacna1s	APN	1	136097132	critical splice donor site	probably null
IGL01773:Cacna1s	APN	1	136118753	missense	probably benign	0.32
IGL02056:Cacna1s	APN	1	136119000	missense	probably benign
IGL02262:Cacna1s	APN	1	136108129	missense	probably damaging	0.98
IGL02324:Cacna1s	APN	1	136075176	splice site	probably benign
IGL02352:Cacna1s	APN	1	136093252	splice site	probably benign
IGL02359:Cacna1s	APN	1	136093252	splice site	probably benign
IGL02370:Cacna1s	APN	1	136085347	missense	probably damaging	1.00
IGL02377:Cacna1s	APN	1	136068994	missense	probably damaging	1.00
IGL02474:Cacna1s	APN	1	136118380	missense	probably benign
IGL02606:Cacna1s	APN	1	136079519	missense	probably damaging	0.99
IGL02833:Cacna1s	APN	1	136071005	missense	probably benign	0.03
IGL02974:Cacna1s	APN	1	136092617	missense	possibly damaging	0.78
IGL03064:Cacna1s	APN	1	136111993	missense	probably damaging	1.00
IGL03093:Cacna1s	APN	1	136116064	missense	probably benign	0.00
IGL03286:Cacna1s	APN	1	136077659	missense	probably benign
brookstone	UTSW	1	136092694	missense	probably benign	0.01
flyfish	UTSW	1	136116061	missense	probably benign	0.21
forelle	UTSW	1	136095858	missense	probably damaging	0.99
river	UTSW	1	136105844	missense	possibly damaging	0.88
stream	UTSW	1	136105814	missense	probably damaging	1.00
BB009:Cacna1s	UTSW	1	136084359	missense	probably damaging	0.99
BB019:Cacna1s	UTSW	1	136084359	missense	probably damaging	0.99
G1Funyon:Cacna1s	UTSW	1	136073441	unclassified	probably benign
N/A:Cacna1s	UTSW	1	136073509	missense	probably benign	0.00
R0030:Cacna1s	UTSW	1	136094989	critical splice donor site	probably null
R0030:Cacna1s	UTSW	1	136094989	critical splice donor site	probably null
R0097:Cacna1s	UTSW	1	136100622	missense	possibly damaging	0.79
R0097:Cacna1s	UTSW	1	136100622	missense	possibly damaging	0.79
R0240:Cacna1s	UTSW	1	136073496	unclassified	probably benign
R0255:Cacna1s	UTSW	1	136118806	missense	possibly damaging	0.93
R0302:Cacna1s	UTSW	1	136100604	missense	probably benign	0.01
R0319:Cacna1s	UTSW	1	136070717	missense	probably damaging	0.99
R0411:Cacna1s	UTSW	1	136113303	missense	probably damaging	1.00
R0413:Cacna1s	UTSW	1	136098209	missense	probably benign	0.00
R0482:Cacna1s	UTSW	1	136113394	missense	probably benign
R0491:Cacna1s	UTSW	1	136089008	splice site	probably benign
R0518:Cacna1s	UTSW	1	136076859	missense	probably benign
R0717:Cacna1s	UTSW	1	136098291	missense	probably damaging	1.00
R0725:Cacna1s	UTSW	1	136098526	splice site	probably benign
R0815:Cacna1s	UTSW	1	136112957	missense	possibly damaging	0.95
R1384:Cacna1s	UTSW	1	136094971	missense	probably benign	0.02
R1518:Cacna1s	UTSW	1	136098551	missense	probably damaging	1.00
R1548:Cacna1s	UTSW	1	136110937	missense	probably damaging	1.00
R1725:Cacna1s	UTSW	1	136098623	missense	probably damaging	1.00
R1728:Cacna1s	UTSW	1	136118716	missense	probably benign
R1729:Cacna1s	UTSW	1	136118716	missense	probably benign
R1730:Cacna1s	UTSW	1	136118716	missense	probably benign
R1739:Cacna1s	UTSW	1	136118716	missense	probably benign
R1762:Cacna1s	UTSW	1	136118716	missense	probably benign
R1783:Cacna1s	UTSW	1	136118716	missense	probably benign
R1784:Cacna1s	UTSW	1	136118716	missense	probably benign
R1785:Cacna1s	UTSW	1	136118716	missense	probably benign
R1800:Cacna1s	UTSW	1	136076854	missense	probably benign
R1924:Cacna1s	UTSW	1	136089017	splice site	probably null
R1969:Cacna1s	UTSW	1	136119095	missense	probably benign	0.42
R2072:Cacna1s	UTSW	1	136079504	missense	probably benign
R2380:Cacna1s	UTSW	1	136095848	missense	probably damaging	1.00
R3110:Cacna1s	UTSW	1	136075093	nonsense	probably null
R3112:Cacna1s	UTSW	1	136075093	nonsense	probably null
R3151:Cacna1s	UTSW	1	136105794	missense	probably damaging	1.00
R3696:Cacna1s	UTSW	1	136105814	missense	probably damaging	1.00
R3722:Cacna1s	UTSW	1	136069042	missense	possibly damaging	0.77
R3804:Cacna1s	UTSW	1	136107018	missense	possibly damaging	0.85
R3813:Cacna1s	UTSW	1	136085347	missense	probably damaging	1.00
R3905:Cacna1s	UTSW	1	136084269	missense	probably damaging	0.99
R3907:Cacna1s	UTSW	1	136084269	missense	probably damaging	0.99
R3909:Cacna1s	UTSW	1	136084269	missense	probably damaging	0.99
R4170:Cacna1s	UTSW	1	136108195	missense	probably damaging	1.00
R4329:Cacna1s	UTSW	1	136119033	missense	probably benign	0.00
R4485:Cacna1s	UTSW	1	136076852	missense	probably damaging	1.00
R4581:Cacna1s	UTSW	1	136070970	splice site	probably null
R4719:Cacna1s	UTSW	1	136118652	splice site	probably benign
R4909:Cacna1s	UTSW	1	136079604	missense	probably damaging	0.99
R4917:Cacna1s	UTSW	1	136101564	critical splice donor site	probably null
R5296:Cacna1s	UTSW	1	136095785	missense	probably benign	0.11
R5411:Cacna1s	UTSW	1	136105811	missense	probably benign	0.09
R5503:Cacna1s	UTSW	1	136086742	missense	probably damaging	1.00
R5533:Cacna1s	UTSW	1	136098375	critical splice donor site	probably null
R5714:Cacna1s	UTSW	1	136112066	missense	probably benign	0.44
R5775:Cacna1s	UTSW	1	136108122	missense	probably damaging	1.00
R5814:Cacna1s	UTSW	1	136107142	missense	probably benign	0.31
R5820:Cacna1s	UTSW	1	136079604	missense	probably damaging	1.00
R5822:Cacna1s	UTSW	1	136112078	missense	probably damaging	1.00
R5877:Cacna1s	UTSW	1	136100667	missense	probably damaging	0.99
R5923:Cacna1s	UTSW	1	136076822	missense	possibly damaging	0.79
R6021:Cacna1s	UTSW	1	136106487	missense	probably benign	0.15
R6037:Cacna1s	UTSW	1	136070967	missense	possibly damaging	0.90
R6037:Cacna1s	UTSW	1	136070967	missense	possibly damaging	0.90
R6056:Cacna1s	UTSW	1	136105836	missense	probably damaging	1.00
R6143:Cacna1s	UTSW	1	136076758	missense	probably damaging	0.99
R6222:Cacna1s	UTSW	1	136104622	missense	probably benign	0.00
R6237:Cacna1s	UTSW	1	136105844	missense	possibly damaging	0.88
R6274:Cacna1s	UTSW	1	136089045	missense	probably benign	0.02
R6609:Cacna1s	UTSW	1	136113391	missense	probably benign	0.30
R6626:Cacna1s	UTSW	1	136094965	missense	probably damaging	1.00
R6838:Cacna1s	UTSW	1	136084437	missense	possibly damaging	0.91
R6848:Cacna1s	UTSW	1	136092694	missense	probably benign	0.01
R6849:Cacna1s	UTSW	1	136092694	missense	probably benign	0.01
R6850:Cacna1s	UTSW	1	136092694	missense	probably benign	0.01
R6851:Cacna1s	UTSW	1	136092694	missense	probably benign	0.01
R6868:Cacna1s	UTSW	1	136092694	missense	probably benign	0.01
R6879:Cacna1s	UTSW	1	136115959	missense	probably benign	0.12
R6893:Cacna1s	UTSW	1	136077693	missense	probably benign	0.05
R7017:Cacna1s	UTSW	1	136095858	missense	probably damaging	0.99
R7228:Cacna1s	UTSW	1	136071059	missense	possibly damaging	0.90
R7283:Cacna1s	UTSW	1	136073708	missense	probably damaging	1.00
R7357:Cacna1s	UTSW	1	136071021	missense	probably damaging	0.99
R7385:Cacna1s	UTSW	1	136092633	missense	probably damaging	0.99
R7421:Cacna1s	UTSW	1	136086802	missense	probably damaging	1.00
R7505:Cacna1s	UTSW	1	136085449	nonsense	probably null
R7519:Cacna1s	UTSW	1	136070756	missense	probably damaging	0.99
R7675:Cacna1s	UTSW	1	136110874	missense	probably damaging	1.00
R7746:Cacna1s	UTSW	1	136069018	missense	probably damaging	0.99
R7779:Cacna1s	UTSW	1	136119029	missense	probably damaging	1.00
R7850:Cacna1s	UTSW	1	136071048	missense	probably damaging	1.00
R7932:Cacna1s	UTSW	1	136084359	missense	probably damaging	0.99
R7935:Cacna1s	UTSW	1	136092595	missense	possibly damaging	0.62
R7950:Cacna1s	UTSW	1	136100625	missense	probably benign	0.01
R7969:Cacna1s	UTSW	1	136076732	missense	probably damaging	1.00
R8083:Cacna1s	UTSW	1	136095791	missense	possibly damaging	0.91
R8101:Cacna1s	UTSW	1	136118665	missense	probably benign	0.02
R8123:Cacna1s	UTSW	1	136108179	missense	probably damaging	1.00
R8191:Cacna1s	UTSW	1	136108155	missense	probably damaging	1.00
R8194:Cacna1s	UTSW	1	136077692	missense	probably benign	0.33
R8251:Cacna1s	UTSW	1	136086723	missense	probably damaging	1.00
R8265:Cacna1s	UTSW	1	136092626	nonsense	probably null
R8301:Cacna1s	UTSW	1	136073441	unclassified	probably benign
R8310:Cacna1s	UTSW	1	136087337	missense	probably damaging	1.00
R8359:Cacna1s	UTSW	1	136116061	missense	probably benign	0.21
R8461:Cacna1s	UTSW	1	136073702	missense	possibly damaging	0.53
R8553:Cacna1s	UTSW	1	136091802	missense	possibly damaging	0.93
R8743:Cacna1s	UTSW	1	136105548	missense	probably damaging	1.00
R8766:Cacna1s	UTSW	1	136075143	missense	probably damaging	1.00
R8884:Cacna1s	UTSW	1	136115243	missense	probably benign	0.05
R8897:Cacna1s	UTSW	1	136117654	missense	probably benign	0.01
R8939:Cacna1s	UTSW	1	136086806	critical splice donor site	probably null
R8953:Cacna1s	UTSW	1	136097432	missense	possibly damaging	0.94
R9039:Cacna1s	UTSW	1	136088319	missense	probably benign
R9058:Cacna1s	UTSW	1	136070698	nonsense	probably null
R9137:Cacna1s	UTSW	1	136069006	missense	possibly damaging	0.89
R9332:Cacna1s	UTSW	1	136092714	nonsense	probably null
R9416:Cacna1s	UTSW	1	136094951	missense	possibly damaging	0.88
R9427:Cacna1s	UTSW	1	136084352	missense	probably benign	0.30
R9446:Cacna1s	UTSW	1	136117624	missense	probably benign	0.00
R9564:Cacna1s	UTSW	1	136118778	missense	probably benign
R9620:Cacna1s	UTSW	1	136108171	missense	probably damaging	1.00
X0025:Cacna1s	UTSW	1	136115970	missense	probably benign	0.00
Z1176:Cacna1s	UTSW	1	136107084	nonsense	probably null
Z1177:Cacna1s	UTSW	1	136117686	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TTCAAAACAAGTGGGGCCAG -3'
(R):5'- ATGTAGGAAACGACCGTGTATC -3'

Sequencing Primer
(F):5'- GGAAAAGCATTTGTGGTCCCAACTC -3'
(R):5'- CGACCGTGTATCATATTTAGTGC -3'

Posted On

2016-02-04