Incidental Mutation 'R4816:Slc34a2'
ID 369784
Institutional Source Beutler Lab
Gene Symbol Slc34a2
Ensembl Gene ENSMUSG00000029188
Gene Name solute carrier family 34 (sodium phosphate), member 2
Synonyms type IIb Na/Picotransporter, D5Ertd227e, NaPi-2b, Npt2b
MMRRC Submission 042434-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4816 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 53206695-53229006 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 53226362 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 495 (N495S)
Ref Sequence ENSEMBL: ENSMUSP00000092380 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094787]
AlphaFold Q9DBP0
Predicted Effect probably damaging
Transcript: ENSMUST00000094787
AA Change: N495S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000092380
Gene: ENSMUSG00000029188
AA Change: N495S

DomainStartEndE-ValueType
Pfam:Na_Pi_cotrans 110 252 2.3e-26 PFAM
Pfam:Na_Pi_cotrans 374 551 2.6e-17 PFAM
low complexity region 553 570 N/A INTRINSIC
low complexity region 616 645 N/A INTRINSIC
low complexity region 649 655 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147243
Meta Mutation Damage Score 0.9055 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency 97% (113/116)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a pH-sensitive sodium-dependent phosphate transporter. Phosphate uptake is increased at lower pH. Defects in this gene are a cause of pulmonary alveolar microlithiasis. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality, embryonic growth arrest, failure of embryo turning and somitogenesis, impaired placental development and impaired yolk sac vascular remodeling. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock
Total: 107 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 C A 7: 45,754,131 (GRCm39) A1562S probably benign Het
Adam30 C A 3: 98,070,061 (GRCm39) D631E possibly damaging Het
Adgrv1 T C 13: 81,676,793 (GRCm39) T2013A probably damaging Het
Ark2n A T 18: 77,740,995 (GRCm39) probably null Het
Baiap3 T A 17: 25,466,269 (GRCm39) probably benign Het
Bicra T C 7: 15,722,831 (GRCm39) T229A possibly damaging Het
C1qbp A G 11: 70,873,190 (GRCm39) probably benign Het
C2cd3 C A 7: 100,040,226 (GRCm39) T265K probably benign Het
Cacna1s T A 1: 136,043,007 (GRCm39) I1331K possibly damaging Het
Cdadc1 AGACGGA AGA 14: 59,806,440 (GRCm39) probably null Het
Cdcp2 A G 4: 106,963,969 (GRCm39) Y273C probably damaging Het
Cdh23 A C 10: 60,244,856 (GRCm39) V1013G possibly damaging Het
Celf3 T A 3: 94,386,529 (GRCm39) I39N probably damaging Het
Cep152 A C 2: 125,405,674 (GRCm39) S1619R probably damaging Het
Cfap36 A G 11: 29,195,108 (GRCm39) I42T probably damaging Het
Cfap61 G T 2: 145,985,020 (GRCm39) V955L probably damaging Het
Cit G A 5: 116,046,750 (GRCm39) D388N probably damaging Het
Clca3a2 T C 3: 144,516,613 (GRCm39) M328V probably benign Het
Cntn4 A T 6: 106,527,458 (GRCm39) I447L probably benign Het
Csmd3 T C 15: 47,721,330 (GRCm39) T1538A possibly damaging Het
Cstf1 A G 2: 172,214,905 (GRCm39) K9E probably damaging Het
Dip2c T A 13: 9,625,186 (GRCm39) M560K probably benign Het
Dsg1a A T 18: 20,466,779 (GRCm39) T550S probably benign Het
Dtnb A G 12: 3,799,505 (GRCm39) E460G probably damaging Het
Dus1l GAGGTAAG GAG 11: 120,680,584 (GRCm39) probably benign Het
Efl1 T A 7: 82,320,927 (GRCm39) V120E probably damaging Het
Fbxl13 T C 5: 21,689,001 (GRCm39) Y769C probably benign Het
Fcho2 T C 13: 98,942,874 (GRCm39) Y22C probably damaging Het
Flacc1 G A 1: 58,709,567 (GRCm39) A196V probably benign Het
Gbp3 T C 3: 142,273,335 (GRCm39) V294A probably damaging Het
Gls A G 1: 52,239,104 (GRCm39) probably benign Het
Gm15130 A T 2: 110,965,714 (GRCm39) probably benign Het
Gm6185 A T 1: 161,040,728 (GRCm39) noncoding transcript Het
Gpr171 T A 3: 59,005,517 (GRCm39) H86L probably damaging Het
Gpr179 T C 11: 97,230,074 (GRCm39) T694A probably damaging Het
H2-Aa A T 17: 34,502,794 (GRCm39) V124E probably damaging Het
H2bc13 A G 13: 21,900,135 (GRCm39) M60T probably benign Het
H2-M5 A G 17: 37,300,309 (GRCm39) probably benign Het
Igf2r A T 17: 12,902,984 (GRCm39) N2355K probably damaging Het
Il9r A C 11: 32,142,654 (GRCm39) S295A possibly damaging Het
Ipo9 T C 1: 135,334,288 (GRCm39) T313A probably benign Het
Kalrn C T 16: 34,334,389 (GRCm39) probably benign Het
Lama3 G A 18: 12,610,661 (GRCm39) V1175M possibly damaging Het
Lhpp T A 7: 132,272,104 (GRCm39) C242* probably null Het
Lipe A G 7: 25,079,568 (GRCm39) S1013P probably damaging Het
Lrrc25 C T 8: 71,070,726 (GRCm39) T169I probably benign Het
Lrrc39 T C 3: 116,362,515 (GRCm39) probably null Het
Lrrd1 T A 5: 3,901,126 (GRCm39) L477* probably null Het
Lrriq4 A G 3: 30,714,196 (GRCm39) I515V possibly damaging Het
Magel2 A G 7: 62,030,840 (GRCm39) Y1248C unknown Het
Maml1 G T 11: 50,149,162 (GRCm39) N859K possibly damaging Het
Mdm1 A T 10: 117,982,782 (GRCm39) H139L possibly damaging Het
Mef2d C T 3: 88,075,397 (GRCm39) P420S possibly damaging Het
Mgat4b A G 11: 50,101,848 (GRCm39) K38E probably benign Het
Mtmr4 T C 11: 87,494,923 (GRCm39) V405A probably damaging Het
Naip5 G A 13: 100,356,195 (GRCm39) T1140M probably benign Het
Naip5 T C 13: 100,356,204 (GRCm39) Q1137R probably benign Het
Naip5 G A 13: 100,356,189 (GRCm39) S1142F probably benign Het
Nfe2l3 T C 6: 51,433,604 (GRCm39) S239P probably damaging Het
Nlrp3 A G 11: 59,439,127 (GRCm39) I235V probably benign Het
Nyap2 T A 1: 81,219,028 (GRCm39) L318Q probably damaging Het
Nynrin G A 14: 56,109,458 (GRCm39) V1522M probably damaging Het
Oog3 A G 4: 143,885,731 (GRCm39) L289P probably damaging Het
Or52n20 C T 7: 104,319,942 (GRCm39) P11L probably benign Het
Or5b107 A G 19: 13,142,488 (GRCm39) I37V probably benign Het
Or6c69b T C 10: 129,627,308 (GRCm39) D50G probably damaging Het
Or8b12b T A 9: 37,684,726 (GRCm39) M257K possibly damaging Het
Or9g20 A T 2: 85,630,391 (GRCm39) N74K probably benign Het
Pax6 T C 2: 105,514,129 (GRCm39) probably benign Het
Pbrm1 G A 14: 30,832,405 (GRCm39) R1441K probably benign Het
Pcdha9 C T 18: 37,132,511 (GRCm39) R527W probably damaging Het
Pcdhb17 T C 18: 37,620,450 (GRCm39) S747P probably benign Het
Pcnx3 A C 19: 5,738,023 (GRCm39) probably null Het
Pds5a A T 5: 65,808,632 (GRCm39) V413E probably damaging Het
Phpt1 G T 2: 25,464,332 (GRCm39) probably benign Het
Phykpl A G 11: 51,483,780 (GRCm39) E220G probably benign Het
Pias2 T C 18: 77,193,587 (GRCm39) probably null Het
Pkhd1 T A 1: 20,269,639 (GRCm39) I3302L probably damaging Het
Poli A G 18: 70,655,822 (GRCm39) L241P probably damaging Het
Ppm1h T A 10: 122,515,284 (GRCm39) I65N possibly damaging Het
Ptpn14 T C 1: 189,588,997 (GRCm39) L954P probably damaging Het
Pxk T G 14: 8,136,893 (GRCm38) M138R probably damaging Het
Rasl11b G T 5: 74,359,058 (GRCm39) D188Y probably damaging Het
Rtraf A G 14: 19,872,644 (GRCm39) F59S probably benign Het
Sanbr A C 11: 23,565,243 (GRCm39) I248S possibly damaging Het
Serpinb5 G T 1: 106,800,069 (GRCm39) L86F probably damaging Het
Setdb2 G A 14: 59,651,095 (GRCm39) T412I probably benign Het
Shank2 C A 7: 143,606,043 (GRCm39) N75K probably damaging Het
Shank3 T A 15: 89,427,318 (GRCm39) I791N probably damaging Het
Slc25a13 T A 6: 6,114,274 (GRCm39) M213L possibly damaging Het
Slc25a21 T C 12: 56,760,623 (GRCm39) Y298C probably damaging Het
Smc2 A G 4: 52,451,231 (GRCm39) T292A probably benign Het
Spag9 T C 11: 93,939,425 (GRCm39) probably benign Het
Tas2r113 C T 6: 132,870,745 (GRCm39) P258S probably benign Het
Tbkbp1 T C 11: 97,029,567 (GRCm39) S530G probably benign Het
Tenm2 A G 11: 35,918,117 (GRCm39) V1881A probably damaging Het
Tm9sf1 C T 14: 55,878,606 (GRCm39) R262Q possibly damaging Het
Tmcc3 G T 10: 94,414,646 (GRCm39) G147V possibly damaging Het
Trim38 A T 13: 23,972,264 (GRCm39) E195V probably damaging Het
Try5 T C 6: 41,290,349 (GRCm39) Y45C probably benign Het
Umad1 A C 6: 8,457,462 (GRCm39) probably benign Het
Vmn2r105 T C 17: 20,428,953 (GRCm39) I708V probably benign Het
Zc3h12d A T 10: 7,743,711 (GRCm39) S494C probably damaging Het
Zeb2 A G 2: 44,887,780 (GRCm39) S382P probably damaging Het
Zfc3h1 A G 10: 115,251,599 (GRCm39) S1304G probably benign Het
Zfp287 G T 11: 62,605,074 (GRCm39) T611K probably damaging Het
Zfp534 G A 4: 147,758,743 (GRCm39) T642I possibly damaging Het
Other mutations in Slc34a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00785:Slc34a2 APN 5 53,222,950 (GRCm39) missense probably benign 0.06
IGL00845:Slc34a2 APN 5 53,215,696 (GRCm39) splice site probably benign
IGL01024:Slc34a2 APN 5 53,224,972 (GRCm39) missense possibly damaging 0.61
IGL01300:Slc34a2 APN 5 53,225,469 (GRCm39) critical splice acceptor site probably null
IGL01680:Slc34a2 APN 5 53,218,218 (GRCm39) missense probably damaging 1.00
IGL02226:Slc34a2 APN 5 53,225,073 (GRCm39) missense probably benign 0.12
IGL02682:Slc34a2 APN 5 53,216,580 (GRCm39) missense possibly damaging 0.64
IGL03294:Slc34a2 APN 5 53,221,340 (GRCm39) missense probably benign 0.00
tucumcari UTSW 5 53,221,351 (GRCm39) missense possibly damaging 0.68
D4216:Slc34a2 UTSW 5 53,222,839 (GRCm39) missense probably benign 0.01
R0094:Slc34a2 UTSW 5 53,221,310 (GRCm39) missense probably benign 0.28
R0227:Slc34a2 UTSW 5 53,226,968 (GRCm39) missense possibly damaging 0.51
R0524:Slc34a2 UTSW 5 53,222,215 (GRCm39) nonsense probably null
R0836:Slc34a2 UTSW 5 53,225,049 (GRCm39) missense probably benign
R1525:Slc34a2 UTSW 5 53,226,848 (GRCm39) missense probably benign 0.00
R1655:Slc34a2 UTSW 5 53,226,761 (GRCm39) missense probably benign 0.00
R1753:Slc34a2 UTSW 5 53,218,733 (GRCm39) missense probably benign 0.37
R1838:Slc34a2 UTSW 5 53,215,778 (GRCm39) missense probably benign
R2361:Slc34a2 UTSW 5 53,225,487 (GRCm39) missense probably benign 0.10
R2405:Slc34a2 UTSW 5 53,215,523 (GRCm39) missense probably benign 0.04
R3688:Slc34a2 UTSW 5 53,222,174 (GRCm39) missense probably benign 0.06
R4108:Slc34a2 UTSW 5 53,221,351 (GRCm39) missense possibly damaging 0.68
R4176:Slc34a2 UTSW 5 53,224,910 (GRCm39) missense probably damaging 1.00
R4380:Slc34a2 UTSW 5 53,226,628 (GRCm39) missense probably damaging 1.00
R4464:Slc34a2 UTSW 5 53,226,524 (GRCm39) missense probably damaging 0.99
R4780:Slc34a2 UTSW 5 53,226,793 (GRCm39) missense probably damaging 1.00
R4934:Slc34a2 UTSW 5 53,224,942 (GRCm39) missense probably damaging 1.00
R5265:Slc34a2 UTSW 5 53,218,776 (GRCm39) missense probably damaging 0.96
R5309:Slc34a2 UTSW 5 53,226,830 (GRCm39) missense probably damaging 0.96
R5313:Slc34a2 UTSW 5 53,226,681 (GRCm39) missense probably damaging 0.96
R5884:Slc34a2 UTSW 5 53,226,722 (GRCm39) missense possibly damaging 0.46
R6084:Slc34a2 UTSW 5 53,224,989 (GRCm39) missense possibly damaging 0.91
R6310:Slc34a2 UTSW 5 53,222,139 (GRCm39) critical splice acceptor site probably null
R6568:Slc34a2 UTSW 5 53,226,476 (GRCm39) missense probably damaging 1.00
R6817:Slc34a2 UTSW 5 53,221,370 (GRCm39) missense probably damaging 0.98
R6845:Slc34a2 UTSW 5 53,226,511 (GRCm39) missense probably damaging 0.96
R6944:Slc34a2 UTSW 5 53,222,225 (GRCm39) missense probably benign
R7873:Slc34a2 UTSW 5 53,215,714 (GRCm39) missense probably benign 0.02
R8114:Slc34a2 UTSW 5 53,225,701 (GRCm39) missense probably benign 0.00
R8158:Slc34a2 UTSW 5 53,218,182 (GRCm39) missense probably damaging 1.00
R8364:Slc34a2 UTSW 5 53,225,716 (GRCm39) missense possibly damaging 0.75
R9158:Slc34a2 UTSW 5 53,221,217 (GRCm39) missense possibly damaging 0.95
R9235:Slc34a2 UTSW 5 53,226,667 (GRCm39) missense probably benign 0.00
R9314:Slc34a2 UTSW 5 53,218,143 (GRCm39) missense possibly damaging 0.61
Z1176:Slc34a2 UTSW 5 53,218,159 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCTCTTCAGTGGGGTTAC -3'
(R):5'- GGGTAGGAAATTCCAGTCCC -3'

Sequencing Primer
(F):5'- TTCAGTGGGGTTACTTCCTTC -3'
(R):5'- GAAATTCCAGTCCCGGAGCTTC -3'
Posted On 2016-02-04